Method for obtaining temperature-sensitive sterile line by performing site-specific mutagenesis on P/TMS12-1 through CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 system

A temperature-sensitive sterile line and site-directed mutation technology is applied in the field of cultivation of rice temperature-sensitive sterile lines, which can solve the problem of reducing the genetic diversity between restorer lines and sterile lines, reducing the expression of light/thermo-sensitive sterile genes, The high sterile starting point temperature of transgenic plants can avoid possible risks, widen the selection range, and minimize the damage to the genome.

Active Publication Date: 2015-05-27
SOUTH CHINA AGRI UNIV
View PDF3 Cites 63 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The three-line method produces hybrid F1 generation seeds by using the cytoplasmic male sterile line and the restorer line, and the hybridization of the maintainer line and the cytoplasmic male sterile line retains the cytoplasmic male sterile line; but only a few rice varieties can be used as the restorer line, which greatly reduces the Genetic diversity between restorer and sterile lines limits the use of heterosis
At present, RNAi technology has been used to interfere with light / temperature-sensitive sterility genes to obtain temperature-sensitive sterile plants; however, RNAi technology only reduces the expression of light / temperature-sensitive sterility genes, and cannot completely inactivate them, making transgenic Plants have a higher sterility threshold temperature, and the sterility threshold temperature is unstable, which affects the safety of seed production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining temperature-sensitive sterile line by performing site-specific mutagenesis on P/TMS12-1 through CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 system
  • Method for obtaining temperature-sensitive sterile line by performing site-specific mutagenesis on P/TMS12-1 through CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 system
  • Method for obtaining temperature-sensitive sterile line by performing site-specific mutagenesis on P/TMS12-1 through CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] The clone obtained by cloning the main gene P / TMS12-1 double-stranded fragment that controls the temperature-sensitive sterility of Pei'ai 64S, the steps are as follows:

[0049] 1) Mapping of the thermosensitive sterile gene p / tms12-1

[0050] On the 12th chromosome of Peiai 64S, there is a major gene p / tms12-1 located in the 5.8kb physical interval between the molecular markers PA301 and PAIDL2 on the 12th chromosome BAC clone AL731757, see figure 1 ;

[0051] 2) Cloning of P / TMS12-1 double-stranded fragment

[0052] Sequence analysis of this interval found that there was a C-G mutation SNP in Pei'ai 64S. Gene prediction in this interval found two possible genes, and the above SNP was located between these two candidate genes; these two predicted genes were used as candidate genes , cloned two DNAs containing the above predicted genes and larger fragments for functional complementation, named PA10.4 (SEQ ID NO.1) and PA9 (SEQ ID NO.2) respectively; between these two...

Embodiment 2

[0056] In the japonica rice variety Zhonghua 11, a temperature-sensitive sterile line was obtained by site-directed mutation P / TMS12-1 using the CRISPR / Cas9 system. The specific steps are as follows:

[0057] 1) Utilize the CRISPR / Cas9 system to design the target sequence according to the SEQ ID NO.4 fragment sequence of Example 1:

[0058] Target-P / TMS12-1-1 (SEQ ID NO. 6): CTAGATGCAGTATAACTTCT;

[0059] 2) Construct the pU3-gRNA vector containing the Target-P / TMS12-1-1 fragment:

[0060] First synthesize the target primer P / TMS12-1-1F (SEQ ID NO.7) with sticky ends: GGCACTAGATGCAGTATAACTTCT, P / TMS12-1-1 (SEQ ID NO.8): AAACAGAAGTTATACTGCATCTAG; denature the adapter primer and move to room temperature Cool to complete the annealing, link the annealed primers to the digested pU3-gRNA carrier; obtain a positive plasmid containing the Target-P / TMS12-1-1 fragment after PCR amplification and sequencing verification;

[0061] 3) Construction of pCRISPR / Cas9 vector containing Targe...

Embodiment 3

[0078] In the japonica rice variety Zhonghua 11, a temperature-sensitive sterile line was obtained by site-directed mutation P / TMS12-1 using the CRISPR / Cas9 system. The specific steps are as follows:

[0079] 1) Utilize the CRISPR / Cas9 system to design the target sequence according to the SEQ ID NO.4 fragment sequence of Example 1:

[0080] Target-P / TMS12-1-2 (SEQ ID NO. 17): CTTCTCGGGTCTATCTATAA;

[0081] 2) Construct the pU6-gRNA vector containing the Target-P / TMS12-1-2 fragment:

[0082] First synthesize the target primer P / TMS12-1-2F (SEQ ID NO.18) with a sticky end (underlined part): GCCGCTTCTCGGGTCTATCTATAA, P / TMS12-1-2R (SEQ ID NO.19): AAACTTATAGATAGACCCGAGAAG; denature the linker primer After moving to room temperature and cooling to complete annealing, the annealed primers were linked to the digested pU6-gRNA carrier, and the positive plasmid containing the Target-P / TMS12-1-2 fragment was obtained by PCR amplification and sequencing verification;

[0083] 3) Constru...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for obtaining a temperature-sensitive sterile line by performing site-specific mutagenesis on P/TMS12-1 through a CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 system. The method comprises the following steps: cloning and controlling a Pei'ai 64S temperature-sensitive sterile major gene P/TMS12-1 fragment; designing a target sequence according to the P/TMS12-1 sequence; constructing a pU3-gRNA carrier of the target-containing sequence fragment; constructing a pCRISPR/Cas9 carrier; obtaining a positive transgenic seedling by utilizing the pCRISPR/Cas9 carrier containing the target sequence fragment; screening a mutant plant from the positive transgenic seeding; performing subculture planting on the mutant plant to obtain the temperature-sensitive sterile line without transgenic components. According to the method disclosed by the invention, the CRISPR/Cas9 system is utilized to completely inactivate P/TMS12-1 non-coding RNA, and the temperature-sensitive sterile line without transgenic components is artificially cultivated. The method disclosed by the invention has the advantages of being strong in purposiveness, small in genome damages and capable of avoiding transgenic interference.

Description

technical field [0001] The invention relates to a method for cultivating a temperature-sensitive sterile line of rice, in particular to a method for obtaining a temperature-sensitive sterile line by using a CRISPR / Cas9 system to mutate P / TMS12-1. Background technique [0002] Rice (Oryza sativa L.) is one of the most important food crops, and more than half of the world's population uses rice as a staple food. With the growth of population and the reduction of arable land, the supply and demand of grain become more and more unbalanced, and increasing the yield per unit area of ​​grain has become one of the key measures to solve the imbalance between supply and demand of grain. Fortunately, hybrid rice can increase the yield by 20-30% compared with conventional high-quality rice, which has played a very important role in solving the problem of food shortage. Therefore, the planting area of ​​hybrid rice has increased year by year, and has now exceeded 60%. [0003] Accordin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/11A01H5/00
Inventor 庄楚雄周海黄志丰姜大刚李静
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap