Application of rice osppr2-1 gene in constructing plants with improved fertility under natural conditions

A rice and gene technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., to achieve good regulation effect, less damage, and increased seed setting rate

Active Publication Date: 2021-08-31
SOUTH CHINA AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the potential safety issues of transgenics have not yet been recognized by people, and the traditional transgenic technology for transforming animal and plant species is to insert foreign DNA fragments into the recipient's genome, modify the gene function, make it express excellent traits, and obtain human needs. varieties, that is, transgenic technology can only do "addition", and its application has certain limitations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice osppr2-1 gene in constructing plants with improved fertility under natural conditions
  • Application of rice osppr2-1 gene in constructing plants with improved fertility under natural conditions
  • Application of rice osppr2-1 gene in constructing plants with improved fertility under natural conditions

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Construction of Gene OsPPR2-1 Mutant Rice Plants

[0046] In the japonica rice variety Zhonghua 11, the CRISPR / Cas9 system mutation OsPPR2-1 (Os02g0110400 or LOC_Os02g0202) was used to obtain plants sensitive to natural environment temperature fertility. The specific method is as follows:

[0047] 1. Construction method

[0048] (1) Target sequence design:

[0049] Target-PPR2-1-U3 (SEQ ID NO.5): GGTGGTTCCGGCGTGTCGA

[0050] (2) Construction of pU3-gRNA vector containing Target-PPR2-1-U3:

[0051] First synthesize target adapter primer pairs with cohesive ends:

[0052] Target-PPR2-1-U3 F (SEQ ID NO. 6): GGCAGGTGGTTCCGGCGTGTCGA,

[0053] Target-PPR2-1-U3 R (SEQ ID NO. 7): AAACTCGACACGCCGGAACCACC;

[0054] After denaturing the adapter primer, move it to room temperature to cool to complete annealing, and link the annealed primer to the digested pU3-gRNA carrier; the positive plasmid is verified by PCR amplification and sequencing. The pU3-gRNA vector cont...

Embodiment 2

[0066] Example 2 Constructing Gene OsPPR2-1 Mutant Rice Plants

[0067] In the japonica rice variety Zhonghua 11, the CRISPR / Cas9 system mutation OsPPR2-1 (Os02g0110400 or LOC_Os02g0202) was used to obtain plants with increased yield. The specific method is as follows:

[0068] 1. Construction method

[0069] (1) Target sequence design:

[0070] Target-OsPPR2-1-U6 (SEQ ID NO. 15): CTGAAGCCGGCGCGACGGT

[0071] (2) Construction of pU6-gRNA vector containing Target-PPR2-1-U6 fragment,

[0072] First synthesize target adapter primer pairs with cohesive ends:

[0073] Target-PPR2-1-U6 F (SEQ ID NO. 16): GCCGCTGAAGCCGGCGCGACGGT,

[0074] Target-PPR2-1-U6 R (SEQ ID NO. 17): AAACACCGTCGCGCCGGCTTCAG;

[0075] Denature the adapter primer and move it to room temperature to cool to complete annealing, link the annealed primer to the digested pU6-gRNA carrier; verify the positive plasmid by PCR amplification and sequencing, and obtain a fragment containing Target-OsPPR2-1-U6 The pU6-...

Embodiment 3

[0087] Example 3 Identification of Fertility Characters of Gene OsPPR2-1 Mutant Plants at Different Temperatures

[0088] 1. Experimental method

[0089] The mutant plants constructed in Examples 1 and 2, which were identified as positive by PCR, were cultivated to maturity and cultured separately so that the booting stages of the plants were respectively placed in high and low temperature environments. High temperature refers to higher than 30°C-38°C, and low temperature refers to lower than 16°C-22°C, observe the morphology of plants in different periods.

[0090] 2. Experimental results

[0091] The results showed that the mutant plants showed normal phenotypes in appearance. Compared with the control plant (japonica rice variety Zhonghua 11), the mutant plant had obvious changes in the following two traits: the number of fertile pollen increased; the number of seed-bearing grains increased. Among them, the observation statistics of the plant phenotype, fertility and fru...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of the rice OsPPR2-1 gene in constructing plants with improved fertility under natural conditions, and a method for constructing plants with improved fertility using gene editing technology. The first research of the present invention shows that the OsPPR2‑1 gene is related to the fertility of rice. Mutating it can reduce the expression of OsPPR2‑1 protein or block the production of OsPPR2‑1 protein, and the fertility can be sensitive to the temperature of the natural environment. Therefore, OsPPR2‑1 1 gene can be used as an effective target for rice genetic breeding. Based on this, a method of using gene editing technology to mutate OsPPR2-1 to obtain natural environment temperature-sensitive mutants has been developed, which has the advantages of strong purpose, less damage to the genome, and avoiding the possible risks brought by transgenes. Compared with wild type plants, the fertility of the mutant plants obtained under natural low temperature conditions is significantly improved, the seed setting rate is significantly increased, and the rice yield is significantly increased. Therefore, the present invention provides a new gene editing target and a new effective breeding approach for cultivating high-yield rice. and methods.

Description

technical field [0001] The invention belongs to the technical field of crop breeding. More specifically, it relates to the application of the rice OsPPR2-1 gene in constructing plants with improved fertility under natural conditions, and a method for constructing plants with improved fertility using gene editing technology. Background technique [0002] Rice (Oryza sativa L.) is an important food crop and monocot model plant. At present, the global population is increasing, the area of ​​arable land is decreasing, environmental pollution is serious, and extreme weather occurs frequently, and the supply and demand of food are becoming more and more unbalanced (Gupta et al., 2006). The production of hybrid rice has solved the problem of food shortage to a certain extent. However, the traditional breeding method has a long period, large investment, high risk, and is affected by interspecific isolation and bad gene linkage. Often, varieties with excellent traits in many aspect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/82C12N15/113C12N15/29C07K14/415A01H5/00A01H6/46
CPCC07K14/415C12N15/113C12N15/8218C12N15/8261C12N15/8287C12N2310/20
Inventor郑少燕卢静沁庄楚雄叶思苗卜文丽
OwnerSOUTH CHINA AGRI UNIV