A method for obtaining thermosensitive sterile lines by site-directed mutation of p/tms12-1 using CRISPR/Cas9 system

A temperature-sensitive sterile line and site-directed mutation technology is applied in the field of cultivation of rice temperature-sensitive sterile lines, which can solve the problem of reducing the genetic diversity between restorer lines and sterile lines, reducing the expression of light/thermo-sensitive sterile genes, The high sterile starting point temperature of transgenic plants can improve the utilization efficiency of heterosis, avoid possible risks and minimize genome damage.

CN104651392BActive Publication Date: 2018-07-31SOUTH CHINA AGRI UNIV
3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Publication Date
2018-07-31

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses a method for obtaining a temperature-sensitive sterile line by site-directed mutation PTMS12-1 using the CRISPR / Cas9 system, including cloning and controlling the main gene P / TMS12-1 fragment of Peiai 64S temperature-sensitive sterile; according to P / TMS12 ‑1 sequence to design the target sequence; construct the pU3‑gRNA vector containing the target sequence fragment; construct the pCRISPR / Cas9 vector; use the above pCRISPR / Cas9 vector containing the target sequence fragment to obtain positive transgenic seedlings; screen mutant plants from the positive transgenic seedlings; The mutant plants are subcultured to obtain thermosensitive sterile lines without transgenic components. The invention utilizes the CRISPR / Cas9 system to completely inactivate the activity of P / TMS12-1 non-coding RNA, artificially cultivate and obtain a temperature-sensitive sterile line without transgenic components, which has the advantages of strong purpose and small genome damage, and avoids the risk of transgenic influences.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to a method for cultivating a temperature-sensitive sterile line of rice, in particular to a method for obtaining a temperature-sensitive sterile line by using a CRISPR / Cas9 system to mutate P / TMS12-1. Background technique

[0002] Rice (Oryza sativa L.) is one of the most important food crops, and more than half of the world's population uses rice as a staple food. With the growth of population and the reduction of arable land, the supply and demand of grain become more and more unbalanced, and increasing the yield per unit area of ​​grain has become one of the key measures to solve the imbalance between supply and demand of grain. Fortunately, hybrid rice can increase the yield by 20-30% compared with conventional high-quality rice, which has played a very important role in solving the problem of food shortage. Therefore, the planting area of ​​hybrid rice has increased year by year, and has now exceeded 60%.

[0003] Accordin...

Examples

Embodiment 1

[0050] The clone obtained by cloning the main gene P / TMS12-1 double-stranded fragment that controls the temperature-sensitive sterility of Pei'ai 64S, the steps are as follows:

[0051] 1) Mapping of the thermosensitive sterile gene p / tms12-1

[0052] On the 12th chromosome of Peiai 64S, there is a major gene p / tms12-1 located in the 5.8kb physical interval between the molecular markers PA301 and PAIDL2 on the 12th chromosome BAC clone AL731757, see figure 1 ;

[0053] 2) Cloning of P / TMS12-1 double-stranded fragment

[0054] Sequence analysis of this interval found that there was a C-G mutation SNP in Pei'ai 64S. Gene prediction in this interval found two possible genes, and the above SNP was located between these two candidate genes; these two predicted genes were used as candidate genes , cloned two DNAs containing the above predicted genes and larger fragments for functional complementation, named PA10.4 (SEQ ID NO.1) and PA9 (SEQ ID NO.2) respectively; between these two...

Embodiment 2

[0060] In the japonica rice variety Zhonghua 11, a temperature-sensitive sterile line was obtained by site-directed mutation P / TMS12-1 using the CRISPR / Cas9 system. The specific steps are as follows:

[0061] 1) Utilize the CRISPR / Cas9 system to design the target sequence according to the SEQ ID NO.4 fragment sequence of Example 1:

[0062] Target-P / TMS12-1-1 (SEQ ID NO. 6): CTAGATGCAGTATAACTTCT;

[0063] 2) Construct the pU3-gRNA vector containing the Target-P / TMS12-1-1 fragment:

[0064] First synthesize the target primer P / TMS12-1-1F (SEQ ID NO.7): GGCACTAGATGCAGTATAACTTCT, P / TMS12-1-1 (SEQ ID NO.8): AAACAGAAGTTATACTGCATCTAG; denature the adapter primer and move to room temperature Cool to complete the annealing, link the annealed primers to the digested pU3-gRNA carrier; obtain a positive plasmid containing the Target-P / TMS12-1-1 fragment through PCR amplification and sequencing verification;

[0065] 3) Construction of pCRISPR / Cas9 vector containing Target-P / TMS12-1-1 f...

Embodiment 3

[0079] In the japonica rice variety Zhonghua 11, a temperature-sensitive sterile line was obtained by site-directed mutation P / TMS12-1 using the CRISPR / Cas9 system. The specific steps are as follows:

[0080] 1) Utilize the CRISPR / Cas9 system to design the target sequence according to the SEQ ID NO.4 fragment sequence of Example 1:

[0081] Target-P / TMS12-1-2 (SEQ ID NO. 17): CTTCTCGGGTCTATCTATAA;

[0082] 2) Construct the pU6-gRNA vector containing the Target-P / TMS12-1-2 fragment:

[0083] First, target primers P / TMS12-1-2F (SEQ ID NO.18) with cohesive ends (underlined parts) were synthesized: GCCGCTTCTCGGGTCTATCTATAA, P / TMS12-1-2R (SEQ ID NO.19): AAACTTATAGATAGACCCGAGAAG;

[0084] Denature the adapter primers and move them to room temperature to cool down to complete annealing. Link the annealed primers to the digested pU6-gRNA carrier, and obtain the target-P / TMS12-1-2 fragment containing Target-P / TMS12-1-2 through PCR amplification and sequencing verification positive pl...