254 results about "Testing types" patented technology

A fluorometer for sensing the fluorescence of a sample utilizes an optical energy source for exciting a sample to be tested and an optical energy detector for detecting the emitted energy from the excited sample. Drive electronics are used for positioning the sample with respect to the optical components allowing a plurality of sample regions to be tested. A processor is utilized to control the operation of the test in accordance with test instructions and for processing the emitted energy detected from the sample to determine test results. A ROM chip socket accepts a plurality of ROM chips, wherein each ROM chip stores test data sets for one or more test types to be performed. ROM chips can be swapped to allow the fluorometer to be configured and reconfigured to perform a plurality of different tests. A communications interface facilitates the sharing of test information between the fluorometer and external entities.

The invention discloses an RT-LAB based microgrid simulation testing system. The system comprises an RT-LAB simulation system, a DSP physical system, a power amplifier, a microgrid physical simulation system and a microgrid monitoring system; the RT-LAB simulation system is used for building microgrid and distribution network simulation models and providing a real-time simulation environment; the DSP physical system is used for producing a control signal to a converter circuit built in the simulation system; the power amplifier is used for connecting the RT-LAB simulation system and the microgrid physical simulation system; the microgrid physical imitating system is used for forming a digital physical microgrid with the RT-LAB simulation system and accepting the monitoring and dispatching control of the monitoring system; the microgrid monitoring system is used for monitoring the DSP physical system, a microgrid digital simulating model and the physical simulation system. According to the system, the microgrid and distribution network simulating models are built on the RT-LAB, the microgrid physical simulation system is provided, so as to truly simulate the running states of a power system and the microgrid; the system has the advantages of real-time simulating, online parameter adjusting, and being rich in interfaces, rich in testing type, flexible to switch the testing mode, simple to operate, safe and reliable, efficient and economical.

According to an aspect of an embodiment, an apparatus is transmitting/receiving an OAM frame containing kinds of tests indicating one or more tests for Ethernet-OAM to/from a relay apparatus, storing configuration information to generate a network configuration needed for each of the plurality of tests in a pseudo manner, distinguishing the kind of test contained in the relevant OAM frame and obtaining network information of a network to which the relay apparatus that transmitted the OAM frame belongs and obtaining configuration information corresponding to the obtained network information obtained from the stored configuration information.

A method, and associated data processing system and computer program product, for generating test cases of different types for testing an application. A functional flow of the application is created based on a system design of the application. Additional test information corresponding to different stages of the functional flow with respect to a test types is generated. The generation of additional test information includes utilizing templates associated with the test types. The test cases are generated based on the additional test information and at least one test case generation rule. The test cases of different types are associated with one another.

A system administrator or service provider executes the risk assessment script that automatically performs a series of hardware, software, and firmware tests on the system. Each test provides the administrator/service provider with a determination output that is standardized into risk assessment levels. Depending on the type of test and the risk level assigned to the determination from the test, the administrator/service provider can recommend various courses of action to reduce the risk to the system.

Method for obtaining physiological muscle values of a user by means of a programmable accelerometer, wherein the method comprises the following operations:

• • selection, by the user, of the type of test to be carried out;
  • measurements of a sequence of acceleration data during the test;
  • emission of sound signals at the beginning, during and at the end of the test. The end of the test is determined by verifying a condition dependent on the type of test selected. The sound signals can indicate the beginning of a test, an action to be carried out during the test, or an error condition during the test;
  • displaying of a value calculated on the basis of said successive measurements of the acceleration and dependent on the type of test selected.

The invention discloses a method and device for generating testing codes. The method comprises the steps that a testing script of tested software is analyzed, and variable information included in the testing script is extracted; original testing codes are classified according to the testing type of the tested software and the programming language of the original testing codes, a differential code portion in each kind of the original testing codes is extracted and marked, and code templates of the original testing codes are formed by the differential code portions and common code portions in the original testing codes; the variable information of the testing script and the corresponding code templates are loaded, the differential code portions marked in the code templates are replaced with the variable information according to set rules, and the testing codes are generated. According to the method and device, the problem that the flexibility of the programming language and the usability of an automatic test framework cannot be obtained at the same time in the prior art can be solved.

The invention discloses a testing system and method for the interference resistance of cab signaling equipment, and belongs to the field of railway signaling. The testing system comprises upper computer control equipment and testing equipment, wherein the upper computer control equipment is used for automatically generating a testing sequence according to testing types selected by a user, calculating parameter values corresponding to the testing sequence, transmitting control commands to the testing equipment and judging the interference resistance of the tested cab signaling equipment according to received testing data, and the testing equipment is used for receiving the control commands transmitted by the upper computer control equipment, generating frequency mixing signals, outputting the frequency mixing signals to the tested cab signaling equipment, receiving the testing data returned by the tested cab signaling equipment and forwarding the testing data to the upper computer control equipment. By the testing system and method, the cab signaling equipment can be variously tested, the testing sequence can be automatically generated, the parameter values needed by testing are calculated, the cab signaling equipment is automatically tested, testing results and testing progress can be displayed in real time, the testing system is convenient to carry, and the testing operation process is simple.

The embodiment of the invention provides a testing method and a testing system for the communication reliability of intelligent electric energy meters. The testing method is on the basis of the testing system for the communication reliability of the intelligent electric energy meters. The testing system comprises a testing host machine, a multi-serial-port card and the at least two intelligent electric energy meters, wherein the testing host machine is used for determining the testing types of communication reliability of the intelligent electric energy meters and transmitting communication frames which correspond to the testing types of communication reliability; the multi-serial-port card is used for distributing the communication frames corresponding to the testing types of communication reliability to the at least two intelligent electric energy meters; the at least two intelligent electric energy meters respond to the received communication frames; and the testing host machine is used for judging the communication reliability of the intelligent electric energy meters according to the response of the intelligent electric energy meters. The testing method realizes the reliability testing on the batched communication of the intelligent electric energy meters.

The invention relates to a testing method and device, a computer-readable storage medium and computer equipment. The method includes the steps of collecting testing plans created through a webpage; receiving execution instructions which are issued by the webpage and correspond to the testing plans; according to the execution instructions, determining testing servers corresponding to the testing types to which testing tasks assigned by the testing plans belong; sending the testing tasks assigned by the testing plans to the determined testing servers to enable the testing servers to execute thetesting tasks; storing the testing information obtained after each testing server completes the corresponding testing task into a database. According to the scheme, tests diversified in type can be uniformed, and the testing efficiency is improved.

Computerized systems and methods are provided for coordinating clinical laboratory testing from initial order entry to results notification. A laboratory testing manager provides a centralized conduit for interfacing entities placing orders for laboratory testing and laboratories performing testing. Entities, such as healthcare providers, patients, and the like, may access the laboratory testing manager to enter orders for laboratory testing. The laboratory testing manager may determine an eligible laboratory to perform the laboratory testing based on information provided in each order, such as the type of testing requested and insurance coverage information. After a laboratory performs testing specified in an order, the laboratory may enter the testing results, which are routed to recipients indicated for the results.

The invention provides a fault diagnosis device and method for a remote sensing satellite receiving system. The method includes the steps that state information of preset monitoring points in devices of the remote sensing satellite receiving system is acquired; parameters of the devices in a servo system, a tracking channel and a data receiving channel of the remote sensing satellite receiving system are set according to a test type, and then an automatic test is finished; various kinds of task information recorded through the remote sensing satellite receiving system in real time in the data receiving task execution process is acquired; according to the acquired state information of the monitoring points, the automatic test information and the various kinds of task information, fault diagnosis of the remote sensing satellite receiving system is finished by establishing a fault diagnosis model and a fault diagnosis expert system. By the adoption of the device and method, fault information in the system can be acquired, found and reported instantaneously, the system fault model is established, and quick and automatic fault diagnosis of the remote sensing satellite receiving system is achieved.

The invention relates to a parameter detection device for a track vehicle steering frame, in particular to a closed adjustable thrust gantry device. The device is designed against the status quo that the positioning of the steering frame and a vehicle body of the prior parameter test table of the steering frame is difficult during the testing process, the whole vehicle test can not be realized and the testing type of the steering frame is single and the like. The device mainly consists of a suspended upper cross beam assembly (I), a lower embedded cross beam (II) and a brace type thrust upright beam assembly (III). The suspended upper cross beam assembly (I), the lower embedded cross beam (II) and the brace type thrust upright beam assembly (III) are connected to a closed whole body by the bolt connection way. The device provides a technical means for positioning the steering frame, positioning the vehicle body and testing the whole vehicle for the steering frame of the track vehicle during the parameter testing process, has the functions of the swing-type steering frame test and the eccentric load test and realizes the purpose of having a plurality of test functions on one testing device. The device has an important role for accelerating the upgrade and replacement process of railway freight car products in China.

A method and apparatus for automatically selecting test types for an analytical meter system based on the insertion into the meter of a test element. The test element can be an analytical element, formed by a test strip with a fluid such as blood applied thereto; a control element, formed by a test strip with control fluid applied thereto; or a standard element, or a standard strip exhibiting known optical properties. By inserting the test element into the analytical meter system, optical properties are measured and the existence of relationships between the measurements are ascertained. Based on the existence or nonexistence of certain relationships, the proper test can be automatically selected by the meter without the need for user interaction. Advantageously, the results of the test can be classified and stored according to test type.

The invention discloses an embedded software testing pile inserting method based on a logic execution block. Firstly a tested program is pretreated according to different coverage testing types. Secondly a structure of the tested program is analyzed to obtain information of statement types, hierarchical relationships, nesting relationships and the like. The tested program is divided according to the information and a logic execution relationship, a probe function is respectively inserted in an inlet position and an outlet position of each logic execution block. The tested program after inserted a pile is operated, pile information is collected, and execution times of sentences of pile inserting point is stated. Finally execution times of the sentences in each section of a code is determined according to the statement types of the pile inserting point and the hierarchical relationships and the nesting relationships of the tested program. The method can clear up the hierarchical relationships and the nesting relationships of the program, and calculates various covering rates including statement covering, judgment covering, condition covering, judgment/condition covering and condition combination covering. The embedded software testing pile inserting method is based on code block pile inserting, greatly reduces expansion ratio after program pile inserting, and reduces influences of the Heisenberg effect on real-time testing.

The invention relates to a testing device for measuring the shearing strength parameter changes in the solidifying process of soft clay and belongs to the technical field of soft clay analyzing devices. The testing device comprises a frame, a loading plate, miniature vane shearing instruments with a pore pressure testing function, a torsion meter, a sample chamber, a measuring unit and a lifting mechanism. The loading plate is arranged above the sample chamber, and the loading plate or the sample chamber is arranged on the frame through the lifting mechanism. The measuring unit comprises sensors used for collecting pore water pressure, soil pressure, displacement and other information. By means of the testing device, a shearing failure mechanism without volume change action or a shearing failure mechanism without pore pressure action can be independently studied, a shearing failure mechanism under volume change and pore pressure coupled action can be studied at the same time, and more testing types are achieved; shearing strength changes caused by soil body changes and pore pressure changes in the loading and solidifying process of soft clay can also be studied, and the changing rules of the shear strength parameters in the whole study process along with the solidifying process can be studied.

A system for performing device-specific testing and acquiring parametric data on custom integrated circuits, for example ASICs, such that each chip is tested individually without excessive test time requirements, additional silicon, or special test equipment. The testing system includes a device test structure integrated into unused backfill space in an ASIC design which tests a set of dummy devices that are identical to some of those of the ASIC. The device test structure includes control logic for designating the type of test and which device types to activate (e.g. pFETs or nFETs), a protection circuit for protecting the SPM when the test is inactive, an isolation circuit for isolating the devices under test (DUT) from any leakage current during test, and a decode circuit for providing test input (e.g. voltages) to the DUT. By controlling which devices to test and the voltage conditions of those devices, the system calculates the relative product yield and health of the line on a die by die basis.

A system configured to detect faults in signal lines. A system includes a first component configured to communicate with a second component via a signal path including one or more signal traces. Sense signal lines are manufactured such that at some point they are in close proximity to a signal trace which is to be monitored. The sense signal lines are configured to use parasitic coupling to redirect a portion of a signal conveyed via a signal trace to a monitoring component. The first component is configured to convey a test signal indicative of a type of test via the signal path, and a reference signal to the monitoring component. The monitoring component is configured to utilize the reference signal to ascertain a presence or absence, or characteristics of a received redirected signal. The monitoring component may optionally utilize a locally generated reference signal.

The invention discloses a spectroscopic method and a device for quickly testing type II infrared superlattice interface quality. The spectroscopic device comprises a Fourier transform infrared measuring system which has a function of step scan, a laser device which serves as a pump light source, a temperature-changing and magnetic-field-changing sample measuring system, a phrase lock amplifier which connects a detector and a circuit control panel in the Fourier transform infrared measuring system, and a wave chopper which is arranged between the temperature-changing and magnetic-field-changing sample measuring system and the laser device. With the spectroscopic device being used, the type II infrared superlattice interface quality is quickly tested through measuring the degree of attenuation of the photoluminescence intensity of type II infrared superlattices along a magnetic field. The test for infrared band In As / Ga Sb type II infrared superlattices of molecular beam epitaxy indicates that the spectroscopic method for quickly testing the type II infrared superlattice interface quality is an optical method capable of quickly and conveniently testing type II infrared superlattice interfaces. The spectroscopic method for quickly testing the type II infrared superlattice interface quality has the advantages of being lossless and sensitive, and is especially suitable for the detection of weak optical signals on the type II infrared superlattice interfaces.

The invention relates to an automated testing system and method. Testing types, testing cases, testing result storage addresses and the like are configured by a control panel, a background establishes Http Connection with an interface according to the configuration, the testing cases are called, an interface return result is acquired and then analyzed, two results are compared by calling a comparison algorithm, and the testing result and a comparison result are stored in corresponding paths. Both functional testing and comparison testing can be performed, testers do not need to test the testing cases one by one, the system can acquire results of all the testing cases once, the testers do not need to manually compare the results, the comparison algorithm is used for intelligent comparison, the system has a downloading function, the function testing result and the comparison testing result can be easily downloaded into various formats by the control panel, the system monitors testing progress and testing states in real time through the control panel, a user can stop testing at any time, and the system is easily operated through interfaces.

A sample processing apparatus comprising: a plurality of testing units arranged along a transport path and each configured to perform at least one type of test; a plurality of transport units configured to collectively constitute the transport path and collectively function to deliver samples to the plurality of testing units for testing; and at least one processor of a computer system and at least one memory that stores programs executable by the at least one processor to: (a) determine a type of test required to be performed on a sample; (b) if a trouble of a transport unit is reported, determine whether there is an available testing unit performable of the required type of test to which the sample is deliverable; (c) if there is the available testing unit, instruct to transport the sample to the available testing unit.

The invention relates to a primer sequence and a probe sequence used for detecting ribonucleotide fragments of type 2 porcine circovirus. The primer sequence comprises a primer pair composed of an upstream primer PCV 2 pf517 and a downstream primer PCV 2 pr615, wherein, the sequence of the upstream primer PCV 2 pf517 is AAATCTCATCATGTCCACCGC, and the sequence of the downstream primer PCV 2 pr615 is GCTACCGTTGGAGAAGGAAAA. The probe sequence comprises probe PCV 2 pb585, the sequence of which is TTCAACACCCGCCTCTCCCGCA.