Unlock instant, AI-driven research and patent intelligence for your innovation.

Small interfering RNA, screening method and application in preparing medicament for treating neuropathic pains

A low-interference, neurological technology, used in DNA/RNA fragments, drug combinations, neurological diseases, etc., to achieve the effect of less side effects

Inactive Publication Date: 2011-07-06
GENERAL HOSPITAL OF PLA
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In the prior art, due to the homology between the sequences of the two exons e37a and e37b, there is only a slight gap, and the amino acids encoded by the two exons differ only by 14. Therefore, the clinically applied N-type VDCCs Blockers, such as ω-Ctx, etc., can produce silencing effects on both e37a and e37b when treating pain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment

[0049] Specific examples include:

[0050]Step 1. Design primers against the gene sequences of EGFP and Cav2.2 e37a / 37b, construct the EGFP-37a / 37b fusion gene by PCR and enzyme digestion, and identify the sequence as correct by PCR, enzyme digestion, sequencing and other methods.

[0051] Step 2. Design four pairs of siRNA according to the design principle of siRNA (such as following the Tuschl rule, etc.), which are respectively coded as No. I, No. II, No. III, and No. IV:

[0052] siRNA I: AAGGATATGTACAGTTTGTTG;

[0053] siRNA II: CAGTTGTTGCGTTGTATTGC;

[0054] siRNAIII: AAGAACTGCCCTCGTAGGTTG;

[0055] siRNAIV: AACTGCCCTCGTAGGTTGGCC.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a small interfering RNA, a screening method and application in preparing medicament for treating neuropathic pains. The method comprises the following steps: firstly, contrasting gene sequences of EGFP and Cav2.2 e37a / 37b to design a primer, constructing EGFP-e37a / 37b fusion genes through a PCR method, and then screening the small interfering RNA with sequence of CAGTTTGTTGCGTTGTATTGC through interference test. The mall interfering RNA can interfere N-shaped calcium channel alpha1 subunits of pain targets, specifically interferes the expression level of an exon e37a mRNA, can generate silencing effect on e37a, but does not act on e37b. The medicament prepared by the small interfering RNA for treating the neuropathic pain has little side effect. The small interferingRNA can be used for preparing the medicament for treating the neuropathic pains (such as neuropathic headache, trigeminal neuralgia, sciatica, intercostal neuralgia, cancerous pain, phantom limb pain and the like).

Description

technical field [0001] The invention relates to a preparation technology of a drug for treating neuropathic pain, in particular to a small interfering RNA, a screening method and an application of preparing a drug for treating neuropathic pain. Background technique [0002] N-type voltage-dependent calcium channels (VDCCs) play an important role in the transmission and regulation of pain. They are densely distributed in the presynaptic terminals of nociceptive neurons in the dorsal horn of the spinal cord, and participate in the regulation of the release of major pain mediators such as glutamate and substance P. [0003] The phenomenon of RNA interference (RNA interference, RNAi) refers to the specific degradation of intracellular mRNA mediated by endogenous or exogenous double-stranded RNA (dsRNA), resulting in the silencing of the expression of target genes and the loss of corresponding functional phenotypes. Mechanism of post-transcriptional gene silencing. In recent ye...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/68A61K31/7088A61P25/04C12N15/113
Inventor 冯泽国吴小兵陈娜张砡李冠华王维
Owner GENERAL HOSPITAL OF PLA