Kit for aided identification of Plum Pox virus and application thereof

A plum pox virus and auxiliary identification technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, fluorescence/phosphorescence, etc., can solve the problems of difficult to determine the copy number of the initial template, false positives, etc., to avoid contamination and human body damage, quantitative identification, and high detection sensitivity

CN101928786AInactive Publication Date: 2010-12-29CHINESE ACAD OF INSPECTION & QUARANTINE
4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Publication Date
2010-12-29
Estimated Expiration
Not applicable · inactive patent

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses a kit for aided identification of Plum Pox virus and application thereof. The kit provided by the invention comprises a special primer pair and / or a special probe, wherein the special primer pair is the primer pair consisting of the DNAs presented by sequence 1 and sequence 2; and the nucleotide sequence of the special probe is presented by sequence 3. The kit of the invention can quickly, detect the Plum Pox virus accurately, stably and quantitatively, can judge whether a sample contains the Plum Pox virus or not according to the fluorescent signal generation condition, and can judge whether the content of the Plum Pox virus in the sample is high or low according to the size of the signal value. The kit has the advantages of strong specificity, high accuracy, simple and convenient operation in a detection process, short time required by detection and the like, and is suitable for quarantine inspection stations, port inspection and quarantine bureaus, plant virus research institutions and the like of agriculture department.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to a kit for assisting identification of plum pox virus and its application. Background technique

[0002] Plum pox virus (PPV) is a member of the genus Potatovirus, and its virions are in the shape of curved rods with a size of 700nm×11nm. It is a quarantine pest in my country. Under natural conditions, PPV has a wide range of hosts and can infect 46 species of woody plants and 150 species of herbaceous plants. Various stone fruit trees such as plums, peaches, apricots and cherries can be affected. Plum pox virus has a wide distribution and has been reported in the United States, Canada, Japan, Egypt, India, Syria, Turkey, Chile, and many European countries. Plum pox virus can be transmitted by aphids in a non-persistent manner, and the spread speed is fast, which may bring disastrous consequences to the development of the entire domestic stone fruit industry in a short period of time. Strengthening the quarantine monitoring of...

Examples

Embodiment 1

[0033] Embodiment 1, the preparation of kit

[0034] The kit consists of specific primer pairs and specific probes.

[0035] Specific primer pairs are as follows:

[0036] Upstream primer (F): 5'-ACTACAGCCTCGCCAGATATG-3' (sequence 1 of the sequence listing);

[0037] Downstream primer (R): 5'-TTTCCATCCAAGCCAAATAAACG-3' (Sequence 2 of the Sequence Listing).

[0038] The pair of specific primers is aimed at nucleotides 677-815 (139 bp) of the 5' end of the CP gene of plumpox virus shown in sequence 4 or sequence 5 of the sequence listing.

[0039] The specific probe (TaqMan probe) (the nucleotide sequence is sequence 3 in the sequence listing) is as follows:

[0040] 5'-(FAM)CTCAATGCTGCTGCCTTCATCTGGA(Eclipse)-3'.

Embodiment 2

[0042]Embodiment 2, the sensitivity measurement of kit

[0043] 1. Preparation of standard curve

[0044] 1. Using the total RNA of PPV as a template, perform PCR amplification with a primer pair composed of PPV-F and PPV-R to obtain a PCR amplification product.

[0045] PPV-F: 5'-CCACCTCCAGTCATACAG-3';

[0046] PPV-R: 5'-AGATACCGAGACCACTACAC-3'.

[0047] The target sequence of PPV-F and PPV-R is the full sequence DNA of the CP gene of plum pox virus shown in sequence 4 of the sequence listing.

[0048] 2. Perform electrophoresis on the PCR amplification product in step 1, cut the gel and recover, and obtain purified DNA.

[0049] 3. Ligate the purified DNA to the pMD18-T vector to obtain the ligation product.

[0050] 4. The ligation product was transformed into Escherichia coli DH5a competent cells, the recombinants were screened, and the plasmid was extracted for PCR identification and sequencing. The results showed that the recombinant plasmid containing the DNA shown ...

Embodiment 3

[0072] Embodiment 3, the specificity determination of kit

[0073] 1. Extraction of viral RNA

[0074] Extract the total RNA of the three viruses (PPV, PVX, PVY) respectively: use the RNA extraction kit (Plant Virus Nucleic Acid Trizol Extraction Kit) to extract the total RNA of the virus to obtain the virus RNA liquid; measure it with a NanoDrop ND-2000 Spectrophotometer quantitative analyzer The concentration and the final concentration are uniformly 1000ng / ul.

[0075] 2. Synthesis of cDNA

[0076] The cDNA of each virus was synthesized respectively, and the cDNA synthesis system was the same as step 2 of Example 2.

[0077] 3. Real-time fluorescent PCR amplification

[0078] The cDNA solution in step 2 was used as a template, and the kit of Example 1 was used to perform real-time fluorescent PCR. The real-time fluorescent PCR reaction system and PCR program are the same as Step 1-6 of Example 1.

[0079] see results figure 2 . PPV showed a typical amplification cur...