Kit and method for rapidly detecting DNA methylation

A kit and methylation technology, applied in the field of biomedical testing, can solve the problems of human suffering, incomplete modification, and low repeatability of experiments, and achieve the goals of saving time-consuming consumables, reducing operation steps, and avoiding cross-contamination Effect

Active Publication Date: 2012-07-25
生工生物工程(上海)股份有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0018] (1) The required amount of DNA is 1-2ug, which requires a large amount of human blood or tissue to be tested in clinical diagnosis, which brings unnecessary pain to the tested person
[0019] (2) The operation is cumbersome, DNA must be extracted first, and then DNA modification is carried out, especially in the bisulfite modification process, which takes 16-18 hours; the purification and desulfo steps are also very long, which seriously affects the work efficiency, and, easy to cause pollution
[0020] (3) Low temperature modification at 50°C for 16-18 hours cannot fully modify, because at this temperature, the supercoiled structure of DNA cannot be opened, resulting in incomplete modification and low repeatability of the experiment
[0021] (4) At present, there are various methylation detection kits on the market. For example, the kit produced by GENMED SCIENTIFICSINC in the United States has 14 kinds of solutions, and the operation steps are as many as 30 steps, which is quite cumbersome; the EZ DNA Methylation- Although the Gold Kit is easy to operate, it is expensive, and the amount of DNA processed each time is only enough to do 2 to 3 PCRs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for rapidly detecting DNA methylation
  • Kit and method for rapidly detecting DNA methylation
  • Kit and method for rapidly detecting DNA methylation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] The preparation of embodiment 1 kit

[0067] The three solutions were prepared according to conventional methods.

[0068] Recipe 1 is as follows:

[0069] (1) Modification solution: 5M sodium bisulfite, 5M ammonium bisulfite, 5mM hydroquinone, 2mM MBT (2-mercaptobenzothiazole), 4M guanidine isothiocyanate, 50mM Tris-HCl pH 5.5;

[0070] (2) Cleaning solution: 35% ethanol, 400mM sodium hydroxide, 200mM sodium chloride;

[0071] (3) Washing solution: 10 mM Tris pH 6.8, 80% ethanol.

[0072] The solvent of the three solutions is water.

[0073] Assemble the kit after aliquoting the modification solution, cleaning solution, and washing solution.

[0074] Recipe 2 is as follows:

[0075] (1) Modification solution: 4M sodium bisulfite, 3M ammonium bisulfite, 7mM hydroquinone, 5mM MBT (2-mercaptobenzothiazole), 2.6M guanidine isothiocyanate, 40mM Tris-HCl pH 6.0;

[0076] (2) Cleaning solution: 30% ethanol, 500mM sodium hydroxide, 200mM sodium chloride;

[0077] (3) Wa...

Embodiment 2

[0086] Example 2: Detection of the HOXC9 gene promoter region in oral epithelial cells

[0087] 1. Sampling: Before sampling, rinse your mouth with clean water, then hold a sterilized medical cotton swab in your hand, insert it into your mouth, wipe it from the buccal mucosa on the inner side of your mouth repeatedly for about 5 minutes, take out the cotton swab, and put the cotton swab into EP containing 1ml TE Wash in the tube, centrifuge at 12,000 rpm for 3 minutes, remove the supernatant, and collect oral epithelial cells.

[0088] 2. Cell lysis: Take 500 ul of the modification solution of formula 1 in Example 1 and put it into a 1.5 ml EP tube, add less than or equal to 20 ul of collected oral epithelial cells into the EP tube filled with the modification solution, mix evenly by inversion, With gentle shaking for 30 seconds, the lysed cells became clear.

[0089] 3. Modification: Divide the above modification liquid into 4 parts and put them into 4 PCR tubes, and perform...

Embodiment 3

[0107] Example 3: Detection of the CRABP1 gene promoter region associated with tumor metastasis in tumor tissue slices

[0108] Tissue section dewaxing: use sterilized forceps to slice paraffin tissue about 30-100mm 2 Clip it into a 1.5ml EP tube, add 100ul xylene, flick the EP tube, let it stand at room temperature for 3min, then centrifuge at 13000rpm for 5min, and discard the supernatant with a pipette. Add 100ul of absolute ethanol, centrifuge at 12000rpm for 2min, and discard the supernatant with a pipette. Add 100ul of 75% ethanol, centrifuge at 12000rpm for 2min, carefully discard the supernatant, and dry the sample.

[0109] Cell lysis: Take 500ul of the modified solution of Formula 1 in Example 1 and put it into the EP tube containing the sample, mix by inverting and shaking slightly for 30 seconds, and the cell lysis becomes clear.

[0110] Follow steps 3-6 in Example 2.

[0111] PCR:

[0112] Upstream primer: 5'TTGAGAAGATGAGGAATGGTGA 3' (SEQ ID NO: 3)

[0113] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit and method for rapidly detecting DNA methylation. Compared with traditional method, the method of the invention has the following four improvements: 1) DNA extraction and DNA modification are completed synchronously; 2) vulcanization accelerator MBT and guanidinium isothiocyanate are added in modifying solution so as to rapidly complete the DNA extraction and DNA modification processes; 3) the modification reaction adopts a short-time high-temperature processing method to ensure that the DNA can be in the desmolysis state, basic groups are fully exposed and cytosines which are not modified through methylation are converted to sulphonated uracils; and 4) the complicated dialysis desalination step after modification is simplified, namely the modified product istransferred in a nucleic acid purification column, then elution is performed after the column is processed with cleaning solution; and the DNA template of the methylated polymerase chain reaction (PCR) of the detected gene can be obtained. The method of the invention has the advantages of low cost, time saving and good repeatability and can be directly used to detect the methylation level of various tissue cell genes and has important use value in the biomedical detection technical aspects such as the early clinical diagnosis.

Description

Technical field: [0001] The invention relates to the technical field of biomedical detection, in particular to a kit and method for rapidly detecting DNA methylation. Background technique: [0002] DNA methylation is an important part of epigenetics (Epigenetics), which is the conversion of cytosine at the 5' end of CpG dinucleotides to 5' methylcytosine under the action of DNA methyltransferases (DNMTs) . In mammals, the frequency of CpG sequences in the genome is only 1%, but in some regions of the genome, usually located in the promoter region or the first exon region of the gene, the CpG sequence density is very high, which can More than 5 times the average value, it becomes the enrichment area of ​​guanine and cytosine, forming the so-called CpG island. DNA methylation plays an important role in normal human development, X chromosome inactivation, aging, and many human diseases (such as developmental deformities, cancer, cardiovascular diseases, diabetes, and neuropsy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68
Inventor张玉武李瑞峰吴俊生
Owner生工生物工程(上海)股份有限公司