Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Carnitine acyl transferase PCCAT2 derived from phytophthora capsici, as well as coding gene and application thereof

A technology of coding and coding sequence, applied in the direction of transferase, application, genetic engineering, etc., can solve the problems of short disease cycle, fast epidemic speed, economic loss and so on

Inactive Publication Date: 2013-10-23
SHANDONG AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Capsicum blight is a devastating disease with a wide distribution worldwide in the cultivation and production of peppers. The disease has a short onset period and a fast epidemic speed, which brings serious economic losses to production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carnitine acyl transferase PCCAT2 derived from phytophthora capsici, as well as coding gene and application thereof
  • Carnitine acyl transferase PCCAT2 derived from phytophthora capsici, as well as coding gene and application thereof
  • Carnitine acyl transferase PCCAT2 derived from phytophthora capsici, as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1. Cloning of carnitine fatty acyltransferase PCCAT2 gene and pathogenicity of PCCAT2

[0060] 1. PCCAT2 Gene Cloning

[0061] Design primers for cloning Phytophthora capsici carnitine acyltransferase PCCAT2 gene:

[0062] CAT-3F: ATGGCTCTGATTCCGCACGGCAGTTT; CAT-3R: TTAAAGCTTCGCTCCAACTTCCGTGGAC.

[0063] Taking the Phytophthora capsicum strain SD33 (Shandong Agricultural University) (J.Phytopathol 157:585-591, 2009) genomic DNA as a template, PCR amplification was carried out with the above primers, and the amplified products were recovered with pGEM-T Easy Vector ( Promega) and transformed into Escherichia coli DH5α, positive clones were screened by blue and white spot screening and plasmid DNA digestion identification, and the plasmids of positive clones were extracted and sequenced. The sequencing results showed that the nucleotide sequence of the PCR product was in the sequence table. Sequence 1 encodes the protein of Phytophthora capsici carnitine fatty a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses carnitine acyl transferase PCCAT2 derived from phytophthora capsici, as well as a coding gene and application thereof. The carnitine acyl transferase PCCAT2 is a protein shown in a) a protein consisting of an amino acid sequence shown in the sequence 2 in the sequence table or b) a protein which is substituted and / or deleted and / or added by one or more amino acid residue shown in the sequence 2 in the sequence table, is related to the phytophthora capsici pathogenicity and derived from the a). The invention provides technical foundation for further study of phytophthora capsici gem molecule detection technology and prevention and research of various plant diseases caused by the phytophthora capsici.

Description

technical field [0001] The present invention relates to a carnitine fatty acyltransferase and its encoding gene and application, in particular to a carnitine fatty acyltransferase from Phytophthora capsici and its encoding gene and application. Background technique [0002] Phytophthora capsici Leonian belongs to the fungal phylum, the flagellate subphylum, the oomycete class, and the downy mildew order. Phytophthora capsicum is a pathogen with a wide host range, which infects other crops besides capsicum. Zhou Qiming et al. reported infecting 21 species of cultivated plants and weeds in 9 families; Ren Guangchi et al. found that the fungus could harm eggplant, cucumber, tomato, cowpea, kidney bean, cabbage, cabbage, radish, carrot, peach, apricot, apple, etc. It has weak infectivity to onions and garlic, but not to citrus and potato stems and leaves. The most pathogenic to pepper. [0003] Pepper blight is a soil-borne disease caused by Phytophthora capsici Leonian, whic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12N15/11C12Q1/68C12Q1/48A01N61/00A01P3/00
Inventor 张修国
Owner SHANDONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com