Carnitine acyl transferase PCCAT2 derived from phytophthora capsici, as well as coding gene and application thereof
A technology of coding and coding sequence, applied in the direction of transferase, application, genetic engineering, etc., can solve the problems of short disease cycle, fast epidemic speed, economic loss and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Example 1. Cloning of carnitine fatty acyltransferase PCCAT2 gene and pathogenicity of PCCAT2
[0060] 1. PCCAT2 Gene Cloning
[0061] Design primers for cloning Phytophthora capsici carnitine acyltransferase PCCAT2 gene:
[0062] CAT-3F: ATGGCTCTGATTCCGCACGGCAGTTT; CAT-3R: TTAAAGCTTCGCTCCAACTTCCGTGGAC.
[0063] Taking the Phytophthora capsicum strain SD33 (Shandong Agricultural University) (J.Phytopathol 157:585-591, 2009) genomic DNA as a template, PCR amplification was carried out with the above primers, and the amplified products were recovered with pGEM-T Easy Vector ( Promega) and transformed into Escherichia coli DH5α, positive clones were screened by blue and white spot screening and plasmid DNA digestion identification, and the plasmids of positive clones were extracted and sequenced. The sequencing results showed that the nucleotide sequence of the PCR product was in the sequence table. Sequence 1 encodes the protein of Phytophthora capsici carnitine fatty a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 