Supercharge Your Innovation With Domain-Expert AI Agents!

Carnitine acyl transferase PCCAT2 derived from phytophthora capsici, as well as coding gene and application thereof

A technology of Phytophthora capsicum and encoding gene, which can be applied in the directions of transferase, application, genetic engineering, etc., can solve the problems of economic loss, fast epidemic speed, short disease cycle and so on.

Inactive Publication Date: 2012-09-12
SHANDONG AGRICULTURAL UNIVERSITY
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Capsicum blight is a devastating disease with a wide distribution worldwide in the cultivation and production of peppers. The disease has a short onset period and a fast epidemic speed, which brings serious economic losses to production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carnitine acyl transferase PCCAT2 derived from phytophthora capsici, as well as coding gene and application thereof
  • Carnitine acyl transferase PCCAT2 derived from phytophthora capsici, as well as coding gene and application thereof
  • Carnitine acyl transferase PCCAT2 derived from phytophthora capsici, as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Embodiment 1, the cloning of carnitine fatty acyltransferase PCCAT2 gene and the pathogenicity of PCCAT2

[0060] 1. PCCAT2 gene cloning

[0061] Design of primers for cloning Phytophthora capsici carnitine acyltransferase PCCAT2 gene:

[0062] CAT-3F: ATGGCTCTGATTCCGCACGGCAGTTT; CAT-3R: TTAAAGCTTCGCTCCAACTTCCGTGGAC.

[0063] Using the genomic DNA of Phytophthora capsici strain SD33 (Shandong Agricultural University) (J. Phytopathol 157:585-591, 2009) as a template, PCR amplification was carried out with the above primers, and the amplified products were recovered and combined with pGEM-T Easy Vector ( Promega) connection, and transformed into Escherichia coli DH5α, positive clones were screened through blue-white screening and enzyme digestion identification of plasmid DNA, and the plasmids of positive clones were extracted for sequencing. The sequencing results showed that the nucleotide sequence of the PCR product was listed in the sequence list. Sequence 1 encodes...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses carnitine acyl transferase PCCAT2 derived from phytophthora capsici, as well as a coding gene and application thereof. The carnitine acyl transferase PCCAT2 is a protein shown in a) a protein consisting of an amino acid sequence shown in the sequence 2 in the sequence table or b) a protein which is substituted and / or deleted and / or added by one or more amino acid residue shown in the sequence 2 in the sequence table, is related to the phytophthora capsici pathogenicity and derived from the a). The invention provides technical foundation for further study of phytophthora capsici gem molecule detection technology and prevention and research of various plant diseases caused by the phytophthora capsici.

Description

technical field [0001] The invention relates to a carnitine fatty acyltransferase, its coding gene and application, in particular to the carnitine fatty acyltransferase from Phytophthora capsici and its coding gene and application. Background technique [0002] Phytophthora capsici Leonian belongs to the phylum Fungi, the subphylum Flagellate, the class Oomycetes, and the order Peronomycetes. Phytophthora capsici is a pathogenic fungus with a wide range of hosts, in addition to infecting peppers, it also infects other crops. Zhou Qiming et al. reported infecting 21 species of cultivated plants and weeds in 9 families; Ren Guangchi et al. found that the fungus can harm eggplant, cucumber, tomato, cowpea, kidney bean, cabbage, cabbage, radish, carrot, peach, apricot, apple, etc. It is weakly infective to onions and garlic, and does not infect citrus and potato stems and leaves. It is the most pathogenic to pepper. [0003] Pepper blight is a soil-borne disease caused by Phy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C12N15/11C12Q1/68C12Q1/48A01N61/00A01P3/00
Inventor 张修国
Owner SHANDONG AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More