Strain producing long chain dibasic acid, and application thereof

A long-chain dibasic acid and a technology for producing strains, which are applied in the field of microorganisms to achieve good market application prospects, wide applicability, and high transformation performance

Active Publication Date: 2012-12-26
CATHAY R&D CENT CO LTD
View PDF9 Cites 48 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the microorganisms used to convert n-alkanes or fatty acids into corresponding long-chain dibasic acids are mainly Candida tropicalis. Reports with strong conversion capabilities, such as:

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Strain producing long chain dibasic acid, and application thereof
  • Strain producing long chain dibasic acid, and application thereof
  • Strain producing long chain dibasic acid, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0048] 1. Preparation of dibasic acid samples: After the fermentation, adjust the pH value to 3.0 with 6mol / L HCl in a 500mL Erlenmeyer flask, add 120mL ether to each bottle, shake it 100 times, let it stand for more than 30min, let it stand for stratification, and take out 40mL ether The extract was added to a 100mL beaker, and the ether was removed to obtain a white solid, which was then measured for dibasic acids.

[0049] 2. Determination of the output of dibasic acid: dissolve the extracted dibasic acid with neutral hot ethanol (95%), add a drop of phenolphthalein, titrate with standard NaOH solution, record the volume of NaOH consumed, and calculate DC 12 Yield.

Embodiment 1

[0051] The Candida tropicalis CAT N145 of the present invention has been verified by subculture experiments, and the colony morphology and the ability to produce long-chain dibasic acids have no obvious changes after multiple subcultures. It can be seen that the passage stability of Candida tropicalis CAT N145 of the present invention is good.

Embodiment 2

[0053] Genomic DNA of the strain was extracted using the Yeast DNAiso Kit kit from TaKaRa Company, and PCR amplification was performed using the genome as a template. The enzyme used in PCR was Pfu enzyme from Biomad Company, and the PCR system and conditions were operated according to the instructions.

[0054] PCR amplification of pox4, fao and cyp52a18 genes, the primers used are shown in the table below.

[0055] pox4s AACGACATAATGACNTTNAC

[0056] pox4a-TTATTTGGACAAAATAGCAG

[0057] faos AAAGGCDTATGAAWCCCAGG

[0058] faoa CATTCAAACAATCTACCATC

[0059] a18s GyGCTGCTCCwrTCACAAAC

[0060] a18a CTArTCrAwCTTGACAATAG

[0061] After PCR was completed, 2 μL of dNTP and 0.5 μL of rTaq enzyme were added, and reacted at 72° C. for 30 min. The PCR product was recovered using the Agarose Gel DNA Purification Kit from TaKaRa Company. The recovered product was connected to the pMD18-T vector, and the connection operation was performed according to the product manual. The ligation...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a strain producing long chain dibasic acid, which is candida tropicalis CAT N145 with a collection number of CCTCC M 2011192. The invention also discloses an application of the strain and a method for producing dibasic acid by using the strain. The candida tropicalis CAT N145 provided by the invention has high conversion capacities upon n-alkanes, fatty acids, and fatty acid derivatives with different carbon chain lengths, and mixtures thereof. Miscellaneous acid content of the produced dibasic acid is low. The application range of the candida tropicalis CAT N145 is wide. With the strain and the application, the controlling over a fermentation process can be greatly simplified, and extraction and purification are easy. The strain has good market application prospect.

Description

technical field [0001] The invention belongs to the field of microorganisms, and in particular relates to a long-chain dibasic acid production strain Candida tropicalis CAT N145 and its application for fermenting and producing long-chain dibasic acids. Background technique [0002] Long-chain dibasic acids are important raw materials for the synthesis of perfumes, nylon engineering plastics, hot-melt adhesives, resins, cold-resistant plasticizers, medicines and pesticides. Especially dodecanedioic acid (DC 12 ) and tetradecanedioic acid (DC 14 ), which are important raw materials for the synthesis of advanced nylon engineering plastics nylon 1212 and nylon 1414 with special properties and wide applications. Long-chain dibasic acids with more than twelve carbons do not exist in nature, and there is currently no economically feasible synthesis method in chemical industry. Therefore, using the specific conversion ability of microorganisms, they can convert n-alkanes or fatty ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/16C12N15/31C12P7/64C12R1/74
Inventor刘驰李乃强廖锦绣刘文山汪江林
OwnerCATHAY R&D CENT CO LTD