Recombined porcine interferon alpha 1, as well as gene encoding gene and expression method thereof
A porcine interferon and gene technology, applied in the direction of interferon, chemical instruments and methods, botany equipment and methods, etc., can solve the problems of unqualified product quality, affecting yield, precipitation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Example 1 Recombinant porcine interferon α1 gene optimization design
[0060] 1. Codon optimization
[0061] There are 64 genetic codes, but most organisms tend to use a subset of these. Those that are most frequently used are called optimal codons, and those that are not frequently used are called rare or low-usage codons. Virtually every organism commonly used for protein expression or production (including E. coli, yeast, mammalian cells, plant cells, and insect cells) exhibits some degree of difference or bias in codon usage. The expression efficiency of genes containing optimal codons in E. coli, yeast and Drosophila was significantly higher than that of genes containing low utilization codons. Therefore, in the heterologous expression system, the codon bias largely affects the expression of recombinant proteins. Gene synthesis using preferred codons and avoiding rare codons is called codon optimization. The optimization process fully takes into account vario...
Embodiment 2
[0085] Embodiment 2: the expression plasmid construction of recombinant porcine interferon α1 gene
[0086] The fragment synthesized from the optimized recombinant porcine interferon α1 gene (as shown in SEQ ID No: 1) was constructed into the pUC57 plasmid (provided by Nanjing GenScript Technology Co., Ltd.) to obtain a long-term preservation plasmid. It is the pUC57-prIFNα1 plasmid. Using the pUC57-prIFNα1 plasmid as a template, the upstream and downstream primers were respectively introduced into NdeI and XhoI restriction sites for PCR amplification. The sequences of the primers used are as follows:
[0087] Upstream primers:
[0088] P1: GGAATTCCATATGTGTGACCTGCCGCAAACGC
[0089] Downstream primers:
[0090] P2: CCGCTCGAGTCATTCCTTTTTGCGCAGACGATC
[0091] The total volume of the reaction was 50 μL, in which 2.5 μL of each primer was added at a concentration of 10 μmol / L, and 1 μL of dNTP at a concentration of 10 mmol / L was added. The DNA polymerase used was Phusion High...
Embodiment 3
[0093] Example 3 Expression and Identification of Recombinant Porcine Interferon α1 in Escherichia coli
[0094] Specific steps are as follows:
[0095] 1. The pET21b-prIFNα1 plasmid with correct sequence alignment in Example 2 was transformed into a competent strain of Escherichia coli BL21 (DE3) (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), and cultured overnight on an ampicillin plate at 37°C.
[0096] 2. On the second day, pick 1-4 recombinant colonies containing the pET21b-prIFNα1 plasmid, insert them into LB medium containing 100 μg / mL ampicillin, and culture them overnight at 37°C.
[0097] 3. Take 50 μL of the overnight culture and insert it into 5 mL of LB induction medium containing 100 μg / mL ampicillin, and culture at 37°C with shaking.
[0098] 4. The OD600 value of the bacterial solution was measured every 1 h after inoculation, and when the OD600=1.0, the expression was induced with 1 mmol / L IPTG (purchased from Amresco). At the same ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More