Method for cell lysis in rt‑PCR reaction buffer

A reaction buffer, RT-PCR technology, applied in the field of RNA expression analysis, can solve problems such as material loss

Active Publication Date: 2018-01-09
F HOFFMANN LA ROCHE & CO AG
View PDF19 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, it remains a challenge to further improve the workflow for PCR and RT-PCR analysis, especially if the analysis can only be performed on RNA originating from only a small number of cells
In conventional real-time PCR, DNA or RNA is first isolated from cells in a time-consuming step that can lead to loss of material

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for cell lysis in rt‑PCR reaction buffer
  • Method for cell lysis in rt‑PCR reaction buffer
  • Method for cell lysis in rt‑PCR reaction buffer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0097] qPCR for amplification of GAPDH gene and RPLI13A gene from sorted mouse hybridoma cells

[0098] A defined number of mouse hybridoma cells were deposited into separate wells of a 96-well microtiter plate using a cell sorter (Beckton Dickinson, FACS Aria I) in such a way that the liquid beam was always directed into the center of the well. However, due to the underlying technology of the cell sorter, it cannot be ruled out that a small percentage of sorted particles are not intact whole cells but cell fragments. Hence, hereinafter, the amount of sorted material will be referred to as cell equivalent.

[0099] Cells sorted as published were dispensed according to the pipetting protocol described below into 96-well microtiter plates (Roche AppliedScience cat. no.: 04 729 692 001 ) designed for use with the LC480 Real-time PCR instrument (Roche Applied Science cat. no.: 05 015 278 001 ) Inside:

[0100] Columns 1-4 1 cell equivalent / well

[0101] 2 cell equivalents / well ...

Embodiment 2

[0131] qPCR for amplification of the Kcnj2 gene from sorted mouse hybridoma cells

[0132] The experiment was performed essentially as disclosed in Example 1 with the modification of using primers and probe designed to amplify a single copy of the mouse gene Kcnj2. Primers and probes are as follows:

[0133] Forward primer ctgtcttgccttcgtgctct (SEQ ID NO: 5)

[0134] Reverse primer agcagggctatcaaccaaaa (SEQ ID NO: 6)

[0135] UPL probe (Roche Applied Science catalog number: 04 688 996 001, No. 76 )

[0136] cell number

[0137] As can be seen from the table, even if only one cell was used as starting material, an amplification signal derived from the single copy number mouse gene Kcnj2 could be obtained. In other words, the present invention provides a technical solution for amplifying a single copy gene from a single cell sample.

[0138] Furthermore, it can be observed that the cp value increases if the sample originates from a higher cell number, eg 64 cells. ...

Embodiment 3

[0142] qPCR for Amplifying the Kcnj2 Gene from Sorted Mouse Hybridoma Cells Using Microtiter Plates Containing Dried Reagents

[0143] The experiment was performed essentially as disclosed in Example 2 with the following changes:

[0144] Fill 10 µl of the solution containing the desired primers and probes into each well of the microtiter plate. The microtiter plate was incubated at 25°C and 200 mBar for 12 hours and then at 25°C and 50 mBar for 4 hours to allow primers and probes to dry on the surface of each reaction well of the microtiter plate.

[0145] Subsequently, cell deposition was performed as follows:

[0146] Columns 1-6 1 cell equivalent / well

[0147] 2 cell equivalents / well in column 7

[0148] 4 cell equivalents / well in column 8

[0149] 8 cell equivalents / well in column 9

[0150] 16 cell equivalents / well in column 10

[0151] 32 cell equivalents / well in column 11

[0152] 64 cell equivalents / well in column 12

[0153] After adding 20 µl of the master m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
volumeaaaaaaaaaa
Login to View More

Abstract

The present invention generally provides a method for amplifying target RNA comprising the steps of (i) transferring a first volume of liquid containing at least one or more living cells into a container, (ii) introducing adding a second volume of RT-PCR reaction buffer, wherein the second volume is at least 2x larger than the first volume, (iii) lysing the RT-PCR reaction buffer in the container by incubating at least 90°C for at least 20 seconds The at least one or more living cells, and (iv) amplifying the target by one-step RT-PCR without intermediate purification steps.

Description

field of invention [0001] The present invention relates to the field of RNA expression analysis by PCR. More specifically, the present invention provides new methods to perform expression analysis starting from material of only a few cells, and to perform subsequent direct analysis of said sample DNA by real-time PCR. Background of the invention [0002] Over the past few decades, PCR has become the "working horse" for DNA analysis because it allows exponential amplification of nucleic acids. In particular, real-time PCR (also known as qPCR) has emerged as a powerful tool, as it allows simultaneous analysis of amplified nucleic acids during amplification, or without intermediate gaps, directly after the amplification reaction by melting curve analysis amplified nucleic acid. [0003] Furthermore, automation of PCR as well as RT-PCR has progressed significantly as qPCR systems are now available which allow parallel execution of 96, 384 or 1536 reactions in microtiter plate ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6851C12Q2561/113C12Q2549/101C12Q2547/101C12Q2521/107
InventorI.霍夫曼H.瓦尔克
OwnerF HOFFMANN LA ROCHE & CO AG