Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method, kit, primer and probe for detecting relative expression quantity of RRM1 (ribonucleotide reductase M1) mRNA (messenger ribonucleic acid)

A technology of relative expression and expression, which is applied in the fields of life science and biology, can solve the problems of high cost and low specificity, and achieve the effect of reducing detection cost, simple operation and high detection accuracy

Active Publication Date: 2014-02-19
JILIN ADICON CLINICAL LAB
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, because SYBR Green I is an unsaturated dye, its specificity is not as good as that of the double-probe hybridization method and the Taqman probe method, and its specificity must be judged by observing the melting curve; and the cost of the double-probe hybridization method is relatively expensive.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method, kit, primer and probe for detecting relative expression quantity of RRM1 (ribonucleotide reductase M1) mRNA (messenger ribonucleic acid)
  • Method, kit, primer and probe for detecting relative expression quantity of RRM1 (ribonucleotide reductase M1) mRNA (messenger ribonucleic acid)
  • Method, kit, primer and probe for detecting relative expression quantity of RRM1 (ribonucleotide reductase M1) mRNA (messenger ribonucleic acid)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] A nucleic acid detection kit for quantitatively detecting the relative expression of RRM1mRNA in a sample, including:

[0049] Red blood cell lysate (TIANGEN)

[0050] Sample RNA extraction solution: QIAGEN RNeasy FFPE Kit;

[0051] Detection system PCR reaction solution: THUNDERBIRD Probe qPCR Mix (2×), RRM1 upstream primer (RRM1-F), downstream primer (RRM1-R) 0.8 μM each, probe (RRM1-probe) 0.4 μM; housekeeping gene actin upstream Primer (Actin-F), downstream primer (Actin-R) each 0.8 μM, probe (Actin-probe) 0.4 μM; among them,

[0052] RRM1-F: GATTTCTCTTACAATTACTTC

[0053] RRM1-R:GCCACTTTTCCATTGATCT

[0054] RRM1-Probe: FAM-CTTTAAGACGCTAGAGCGGTCTTATTT-TAMRA

[0055] Actin-F: TGAGCGAGGCTACAGCTT

[0056] Actin-R: TCCTTGATGTCGCGCACGATTT

[0057] Actin-Probe: FAM-ACCACCACGGCCGAGCGG-TAMRA;

[0058] Positive control substance: solution containing RRM1 gene;

[0059] Negative control substance: solution without RRM1 gene;

[0060] Blank control substance: normal s...

Embodiment 2

[0062] The using method of kit of the present invention:

[0063] (1) Extract tissue RNA from paraffin sections: cut out the tissue or paraffin section samples and put them in a 1.5ml centrifuge tube (scrape); add 1ml of tissue clear solution, shake and mix, and centrifuge at 13000rpm for 1min; remove the supernatant and add 500ml of tissue For transparent liquid, shake and mix and centrifuge at 13,000rpm for 1min; remove the supernatant, add 1ml of absolute ethanol, shake and mix, and centrifuge at 13,000rpm for 1min; remove the supernatant and put it in a metal bath at 37°C for 10min (open the cover) until the liquid is dry; refer to QIAGEN RNeasy FFPE Kit paraffin RNA extraction kit manual, extract sample RNA.

[0064] (2) Refer to the instruction manual of the Rever Tra Ace qPCR RT Kit kit from TOYOBO, and reverse-transcribe the sample RNA extracted in (1) into cDNA.

[0065] (3) Reagent configuration: according to the number of people to be tested, X ul of the PCR reacti...

Embodiment 3

[0075] Using the nucleic acid detection method of the present invention to detect clinical samples

[0076] Take 20 cases of paraffin section samples of non-small cell lung cancer (NSCLC) patients submitted for inspection, extract tissue RNA, prepare reagents and detect according to the method described in Example 2.

[0077] For each sample, 2ul of cDNA generated by reverse transcription was taken and added to the PCR reaction solution of the detection system. At the same time, do positive, negative, and blank control experiments, and a standard curve for the housekeeping gene / target gene. A 96-well fluorescent PCR instrument can detect 20 samples at the same time, each sample is repeated twice, a positive control, a negative control and a blank control. The detection time is only 100 minutes.

[0078] The experimental results are compared with the reported results of the immunohistochemical test to determine the accuracy of the sample detection. Some positive results are ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for quantitatively detecting the relative expression quantity of RRM1 (ribonucleotide reductase M1) mRNA (messenger ribonucleic acid) in a sample. In the method, the relative expression quantity of RRM1mRNA in the sample can be quantitatively detected by use of the real-time fluorescence quantification PCR (polymerase chain reaction) technology. The invention provides a primer and a probe for quantitatively detecting the relative expression quantity of RRM1 mRNA in the sample, wherein the primer and the probe comprise upstream and downstream primers RRM1-F / RRM1-R and a probe RRM1-Probe for detection as well as upstream and downstream primers Actin-F / Actin-R and a probe Actin-Probe for a house-keeping gene actin. The invention also provides a kit for quantitatively detecting the relative expression quantity of RRM1 mRNA in the sample. By calculating the ratio of the expression quantity of RRM1 in the sample obtained by the method to the normal base of a healthy person, obtained by statistics, the relative expression quantity of RRM1 mRNA is obtained, the detection time can be effectively saved, and the detection accuracy is improved.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and relates to a method and kit for quantitatively detecting the relative expression of RRM1mRNA in a sample and the primers and probes used therefor. By using real-time fluorescent quantitative PCR technology, the RRM1mRNA in the sample can be detected Quantitative detection of relative expression. Background technique [0002] Today, lung cancer is one of the malignant tumors with the highest mortality rate in the world. According to pathological classification, about 80%-85% of diagnosed lung cancers are non-small cell lung cancer (NSCLC). Due to the lack of effective early diagnosis methods, about 75% of patients at the first diagnosis have missed the best opportunity for surgery. At present, the main indicators for predicting the chemotherapy response of NSCLC patients are not clear, and it is also one of the hot spots in the field of lung cancer research. There is a view that...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6851C12Q1/686C12Q1/6876C12Q2545/114C12Q2561/101C12Q2600/106C12Q2600/158C12Q2531/113
Inventor 周晓犊陈奕磊王淑一徐建成
Owner JILIN ADICON CLINICAL LAB
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More