Supercharge Your Innovation With Domain-Expert AI Agents!

Method for preparing and detecting quick detection kit of raccoon component in foods and feeds

A detection kit, the technology of the kit, applied in the direction of biochemical equipment and methods, microbial determination/inspection, etc., can solve problems related to religious belief, harm consumers' interests, endanger human health, etc., and achieve high sensitivity and operation. Simple, specific results

Inactive Publication Date: 2015-04-01
INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This kind of behavior of producing and selling counterfeit products may not only endanger human health, but also involves religious beliefs, which seriously damages the interests of consumers.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing and detecting quick detection kit of raccoon component in foods and feeds
  • Method for preparing and detecting quick detection kit of raccoon component in foods and feeds
  • Method for preparing and detecting quick detection kit of raccoon component in foods and feeds

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Make the real-time fluorescent PCR detection kit of raccoon dog composition according to the following formula, and reagent wherein comprises as follows:

[0043] (1) 2×PCR Master Mix

[0044]Contains 0.05 u / μL Taq DNA polymerase, reaction buffer, 4 mmol / L magnesium chloride, 0.4 mmol / L dNTP (dATP, dCTP, dGTP, dTTP);

[0045] The reaction buffer contains 20 mmol / L tris-hydrochloric acid at pH 8.8, 100 mmol / L potassium chloride and 2% Triton X-100;

[0046] (2) Upstream primer: 10 μmol / L, sequence: 5'- AATCTTGCCTGGGTTTGGAA -3';

[0047] (3) Downstream primer: 10 μmol / L, sequence: 5'- CAGTAAATATGTGGTGGGCTCACA -3';

[0048] (4) Taqman-MGB probe: 10 μmol / L, the sequence is: 5'- CATACTACTCCGGGAAAA -3'.

[0049] Follow the procedure below for testing:

[0050] (1) Extraction of DNA from non-raccoon samples

[0051] A. Weigh 0.1 g of sample and add it to a 2 mL centrifuge tube. Add 600 μL of preheated CTAB lysis buffer and 40 μL of proteinase K, mix gently, and incubate...

Embodiment 2

[0069] Make the real-time fluorescent PCR detection kit of raccoon dog composition according to the following formula, and reagent wherein comprises as follows:

[0070] (1) 2×PCR Master Mix

[0071] Contains 0.05 u / μL Taq DNA polymerase, reaction buffer, 4 mmol / L magnesium chloride, 0.4 mmol / L dNTP (dATP, dCTP, dGTP, dTTP);

[0072] The reaction buffer contains 20 mmol / L tris-hydrochloric acid at pH 8.8, 100 mmol / L potassium chloride and 2% Triton X-100;

[0073] (2) Upstream primer: 10 μmol / L, sequence: 5'- AATCTTGCCTGGGTTTGGAA -3';

[0074] (3) Downstream primer: 10 μmol / L, sequence: 5'- CAGTAAATATGTGGTGGGCTCACA -3';

[0075] (4) Taqman-MGB probe: 10 μmol / L, the sequence is: 5'- CATACTACTCCGGGAAAA -3'.

[0076] Follow the procedure below for testing:

[0077] (1) Extraction of DNA from raccoon samples with different contents

[0078] A. Add liquid nitrogen to raccoon meat and mutton, grind them into powder, weigh 0.1 g each, and add them to a 2 mL centrifuge tube....

Embodiment 3

[0098] Make the real-time fluorescent PCR detection kit of raccoon dog composition according to the following formula, and reagent wherein comprises as follows:

[0099] (1) 2×PCR Master Mix

[0100]Contains 0.05 u / μL Taq DNA polymerase, reaction buffer, 4 mmol / L magnesium chloride, 0.4 mmol / L dNTP (dATP, dCTP, dGTP, dTTP);

[0101] The reaction buffer contains 20 mmol / L tris-hydrochloric acid at pH 8.8, 100 mmol / L potassium chloride and 2% Triton X-100;

[0102] (2) Upstream primer: 10 μmol / L, sequence: 5'- AATCTTGCCTGGGTTTGGAA -3';

[0103] (3) Downstream primer: 10 μmol / L, sequence: 5'- CAGTAAATATGTGGTGGGCTCACA -3';

[0104] (4) Taqman-MGB probe: 10 μmol / L, the sequence is: 5'- CATACTACTCCGGGAAAA -3'.

[0105] Follow the procedure below for testing:

[0106] (1) Extraction of DNA from the meat roll sample to be tested

[0107] A. Weigh 0.3 g of meat roll sample and add it to a 2 mL centrifuge tube. Add 600 μL of preheated CTAB lysis buffer and 40 μL of proteinase K, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing and detecting a quick detection kit of a raccoon component in foods and feeds, belongs to qualitative detection technology of animal origin ingredients in foods and feeds, and in particular relates to a kit and method for detecting raccoon component in foods and feeds by a real-time fluorescent PCR (polymerase chain reaction) technology. The kit comprises 2*PCR MasterMix, an upstream primer, a downstream primer and a Taqman probe, wherein the 2*PCR MasterMix contains TaqDNA (deoxyribonucleic acid) polymerase, a reaction buffer solution, magnesium chloride and dNTP (diethyl-nitrophenyl thiophosphate); the quick detection method of raccoon component comprises the steps of extracting DNA of foods and feeds, performing real-time fluorescent PCR amplification of the raccoon component, and determining the result. The method has the advantages of quickness, strong specificity, convenience in operation, good repeatability, is high in sensitivity, can be used for detecting the raccoon component with content as low as 0.00001 percent.

Description

technical field [0001] The invention relates to a method for rapid detection of animal-derived components by using nucleic acid amplification technology, in particular to a real-time fluorescent PCR detection method for raccoon dog components. Background technique [0002] Raccoon dog, also known as raccoon dog, belongs to Mammalia, Carnivora, Canidae, and Nyctereutes in zoological classification. It is mainly distributed in the countries of the former Soviet Union, China, North Korea, Japan, Mongolia, Finland and other countries, and it is distributed in almost every province in my country. Raccoon is a precious fur animal. Raccoon fur is a large capillary skin, which has the advantages of toughness, wear resistance, lightness, softness, beauty and heat preservation. It is a high-quality raw material for making fur products such as coats, fur collars, hats and fur mattresses. The guard hair and tail hair of raccoon dogs can be used to make advanced cosmetic brushes, beard ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q2561/101C12Q2561/113
Inventor 孙敏高宏伟封立平刘彩霞
Owner INSPECTION & QUARANTINE TECH CENT SHANDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More