Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Probes, kits and methods for typing and detecting four types of human malaria parasites

A Plasmodium and kit technology, applied in the field of Plasmodium malariae probes, Plasmodium ovale, detection of Plasmodium falciparum, and Plasmodium vivax, can solve laborious and time-consuming problems

Active Publication Date: 2017-04-12
CHINA INSPECTION LAB TECH CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the PCR method is still labor-intensive and time-consuming, requiring multiple tests to determine mixed infections

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probes, kits and methods for typing and detecting four types of human malaria parasites
  • Probes, kits and methods for typing and detecting four types of human malaria parasites
  • Probes, kits and methods for typing and detecting four types of human malaria parasites

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0038] 1. Test materials and methods

[0039] 1.1 Test material

[0040] Four Plasmodium artificially synthesized fragments were synthesized with reference to the published sequences on Genbank (M19172, AF488000, L48987, X13926), the fragments were ligated into the pMD18-T vector, and transformed into competent cells DH5α, with 30% glycerol. Store in bacterial liquid form.

[0041] Synthetic plasmids and genomic DNA of clinical samples were provided by Beijing Inspection and Quarantine Bureau.

[0042] 1.2 Probe Design

[0043] The DNAMAN software was used to compare the amplified fragments of the four universal upstream and downstream primers (5'-3': GAGGGCAAGTCTGGTGCCAG, 5'-3': CATCTGAATACGAATGTCCCCAAGC), and the differential sequences were selected to design four types of probes for the detection of Plasmodium. Needle (SEQ No. 1-SEQ No. 4), primers and probes were synthesized by Invitrogen, the 5' end of the primer was labeled with biotin, and 10 T tails were added to th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a probe for classificatory diagnosis of four plasmodia infecting human, a kit and a using method thereof, wherein species special probes are respectively adopted for plasmodium falciparum, plasmodium vivax, plasmodium ovale and plasmodium malariae; 10 T tails are added at the 5' end of the probe and are cross-linked and fixed on a nylon hybrid membrane in an ultraviolet manner. The kit consists of PCR and reverse dot blot hybridization reaction reagents and materials and can be used for classificatory diagnosis of plasmodium falciparum, plasmodium vivax, plasmodium ovale and plasmodium malariae or two or three or four of the plasmodium falciparum, plasmodium vivax, plasmodium ovale and plasmodium malaria, so that the invention provides a simple, convenient and quick plasmodium classificatory diagnosis technique.

Description

technical field [0001] The present invention relates to a probe, a kit and a method for using the same for the detection of Plasmodium typing, in particular to a probe for detection of Plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, and Plasmodium vivax. The invention discloses a needle, a kit and a using method thereof, belonging to the field of detection of malaria parasites. Background technique [0002] Plasmodium is a genus of protozoa, Sporozoa, Cocciidea, Haemosporidiidea, and Plasmadiidea, which is the general name for Plasmodium. The parasites in humans include Plasmodium falciparum, Plasmodium vivax, Plasmodium ovals, and Plasmodium malariae. P. vivax is the most widely distributed in my country, covering the whole country except the Qinghai-Tibet Plateau. Plasmodium falciparum is next, distributed in the south of Qinling-Huaihe, with Yunnan-Guizhou, Guangdong and Guangxi and Hainan as the most. Three-day malaria has scattered cases in the northern an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12R1/90
CPCC12Q1/6834C12Q1/6893C12Q2531/113C12Q2525/173Y02A50/30
Inventor 邹明强薛强殷宏王飞刘翌马吉湘
Owner CHINA INSPECTION LAB TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products