Probes, kits and methods for typing and detecting four types of human malaria parasites
A Plasmodium and kit technology, applied in the field of Plasmodium malariae probes, Plasmodium ovale, detection of Plasmodium falciparum, and Plasmodium vivax, can solve laborious and time-consuming problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0038] 1. Test materials and methods
[0039] 1.1 Test material
[0040] Four Plasmodium artificially synthesized fragments were synthesized with reference to the published sequences on Genbank (M19172, AF488000, L48987, X13926), the fragments were ligated into the pMD18-T vector, and transformed into competent cells DH5α, with 30% glycerol. Store in bacterial liquid form.
[0041] Synthetic plasmids and genomic DNA of clinical samples were provided by Beijing Inspection and Quarantine Bureau.
[0042] 1.2 Probe Design
[0043] The DNAMAN software was used to compare the amplified fragments of the four universal upstream and downstream primers (5'-3': GAGGGCAAGTCTGGTGCCAG, 5'-3': CATCTGAATACGAATGTCCCCAAGC), and the differential sequences were selected to design four types of probes for the detection of Plasmodium. Needle (SEQ No. 1-SEQ No. 4), primers and probes were synthesized by Invitrogen, the 5' end of the primer was labeled with biotin, and 10 T tails were added to th...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com