Brown planthopper carbonic Anhydrase (CA) gene fragment and its application

A brown planthopper and brown planthopper-resistant technology, applied in the direction of DNA/RNA fragments, application, genetic engineering, etc., can solve the problems of reducing related genes, destroying the conduction tissue of rice plants, and the lethal effect of brown planthopper is not obvious, and achieves the effect of broad application prospects

Inactive Publication Date: 2016-03-30
SHANDONG CROP GERMPLASM CENT
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

2. When the brown planthopper lays eggs, the ovipositor stabs the stem tissue of the rice plant, forming a large number of wounds, causing the water to disperse, and destroying the conduction tissue of the rice plant at the same time, accelerating the lodging of the rice plant
Although the use of these transgenic rice lines can reduce the transcription level of related genes to a certain extent, the lethal effect on BPH is not obvious
Therefore, so far, no relevant target gene of brown planthopper has been cloned at home and abroad, and the purpose of controlling brown planthopper can be achieved by silencing the gene through transgenic rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brown planthopper carbonic Anhydrase (CA) gene fragment and its application
  • Brown planthopper carbonic Anhydrase (CA) gene fragment and its application
  • Brown planthopper carbonic Anhydrase (CA) gene fragment and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] The cloning method of embodiment 1.CA gene fragment:

[0045] (1) A total of 50 nymphs of different instars of N. lugens were collected, and the total RNA was extracted by Trziol method.

[0046] 1) Put it into an RNase-free mortar pre-cooled with liquid nitrogen, add liquid nitrogen and grind quickly, grind until powdery and quickly transfer to a pre-cooled 2ml centrifuge tube.

[0047] 2) Add 1ml Trizol, mix gently upside down, and place at room temperature for 5 minutes.

[0048] 3) Add 1 / 5 volume of Trizol (ie 200 μl) of chloroform, shake vigorously for 20 seconds, and place on ice for 3 minutes. Centrifuge at 12,000×g for 15 minutes at 4°C.

[0049] 4) Transfer the upper aqueous phase to another 1.5ml centrifuge tube, and add isopropanol with an equal volume to water. Gently mix the centrifuge tube upside down and let it stand at room temperature for 15 minutes. Centrifuge at 12,000×g for 15 minutes at 4°C.

[0050] 5) Pour off the supernatant, add 1 ml of 75%...

Embodiment 2

[0063] Embodiment 2.dsRNA synthesis and recovery

[0064] (1) According to the CA gene fragment sequence verified by sequencing, primers P3 (SEQ ID NO: 5) and P4 (SEQ ID NO: 6) were designed, and the T7 promoter sequence TAATACGACTCACTATAGGG was added to the 5' end of the upstream and downstream primers. The correctly sequenced pMD18-CA plasmid in Example 1 was used as a template. Primers P5 (SEQ ID NO: 7) and P6 (SEQ ID NO: 8) with a T7 promoter were designed, and the Pmd18-GFP plasmid was used as a template to amplify to obtain a synthetic template of dsGFP.

[0065] Upstream primer (P3):

[0066] 5'-TAATACGACTCACTATAGGGATGGTCGGATTCCACAACATGTTTC-3'

[0067] Downstream primer (P4):

[0068] 5'-TAATACGACTCACTATAGGGCTCACAAACACCTTCCTGTGTCC-3'

[0069] Upstream primer (P5):

[0070] 5'-TAATACGACTCACTATAGGGATGAGTAAAGGAGAAGAAC-3'

[0071] Downstream primer (P6):

[0072] 5'-TAATACGACTCACTATAGGGTTTGTATAGTTCATCCATGC-3'

[0073]Amplification reaction conditions: 94°C, 1min; 94...

Embodiment 3

[0083] Embodiment 3.dsRNA feeding experiment (see Figure 5 )

[0084] (1) Select a glass test tube with openings at both ends and a length of 9.5 cm and a diameter of 2.5 cm as a container for feeding brown planthopper. One end was first sealed with a layer of parafilm, 60 μl of artificial feed was added, and then sealed with a layer of parafilm, so that the added artificial feed was evenly distributed between the two layers of film.

[0085] (2) Insert 30 3rd instar nymphs of the brown planthopper with uniform growth and development, and seal the other end of the test tube in the same step as (1).

[0086] (3) Use black cloth (or opaque material) to protect the test tube with the feed from light, so that the brown planthopper tends to feed on the ends that have been added with artificial feed and sealed with parafilm, and replace with new dsRNA feed every 24 hours. The experiment was carried out in an artificial climate chamber, and the setting conditions were: temperature...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a brown planthopper carbonic anhydrase (CA) gene segment and application thereof. The sequence of a brown planthopper CA gene is shown as SEQ ID No.1, and the sequence of dsRNA is shown as SEQ ID No.2. The gene can be used for inhibiting brown planthoppers from growth so as to control the survival rate of the brown planthoppers. The gene can be transferred in rice, so as to research the biological influence of transgenic rice on the brown planthoppers. Therefore, the invention provides a new efficient path for continuously preventing and controlling brown planthoppers.

Description

technical field [0001] The present invention relates to the field of biotechnology. It specifically relates to the brown planthopper CA gene fragment and its dsRNA and the application of the dsRNA to lethal brown planthopper. Background technique [0002] Brown planthopper ( ) Brownplanthopper (BPH) belongs to Hemiptera (Hemiptera), planthopper family (Delphacidae). Oligophagous pests can only complete normal development and life cycle on rice (Oryza sativa L.) and common wild rice under natural conditions (Sogawa1982; Wu Guorui et al., 1987). It is an important pest on rice crops in my country. The brown planthopper is an oligophagous pest. It causes serious damage to rice through the following ways: 1. Direct piercing and sucking damage. Both adults and nymphs suck rice tissue juice with piercing-sucking mouthparts, It absorbs plant nutrients, affects the normal growth of rice, slows plant growth and reduces yield. When the rice plants are severely damaged, they even f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/60C12N15/113A01N57/16A01P7/04C12N15/82A01H5/00
Inventor杨永义丁汉凤姚方印李娜娜宫永超蒲艳艳
OwnerSHANDONG CROP GERMPLASM CENT