Application of brown planthopper PIB14 protein and coding gene thereof to regulation and control of brown planthopper resistance of plants

A technology that encodes genes and resists brown planthoppers, applied in the field of genetic engineering, can solve problems such as harm to humans and animals, environmental pollution, etc., and achieve the effects of reducing the use of pesticides, good application prospects, maintaining ecological balance and sustainable development

Active Publication Date: 2021-08-13
WUHAN UNIV +2
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, insecticides are generally used to control brown planthoppers, but with the large-scale use of insecticides, brown planthoppers have developed resistance, such as methipex, carbofuran, propmetpine, and even synthetic pyrethrins (Nagata, 1982; Lakshmi et al., 2010)
And spraying pesticides is not only harmful to humans and animals, but also causes serious environmental pollution.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of brown planthopper PIB14 protein and coding gene thereof to regulation and control of brown planthopper resistance of plants
  • Application of brown planthopper PIB14 protein and coding gene thereof to regulation and control of brown planthopper resistance of plants
  • Application of brown planthopper PIB14 protein and coding gene thereof to regulation and control of brown planthopper resistance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Cloning of Example 1 Brown Planthopper PIB14 Gene

[0038] Total RNA was extracted from 20 brown planthoppers of biotype 1 and reversed to cDNA. Primers were designed based on the sequence, and the 5' and 3' end sequences of the candidate gene were obtained using TaKaRa's 5' and 3' RACE kits, the transcription start site and termination site of the candidate gene were determined, and spliced ​​out The full-length cDNA sequence of the gene. Re-synthesize primers PIB14-F and PIB14-R according to the full-length cDNA sequence, amplify the full-length cDNA of PIB14, and predict the ORF, and its ORF sequence is shown in the sequence table SEQ ID NO.1 ( figure 1 ).

[0039] PIB14-F: 5'-ACATGGGGCTCATTTTCTCCAAGCAT-3'

[0040] PIB14-R: 5'-GTATTTTATTTATTAAAAACACAAG-3'

Embodiment 2

[0041] Example 2 Preparation of the dsRNA (dsPIB14) for silencing the PIB14 gene of the brown planthopper and the green fluorescent protein GFP gene dsGFP for the control

[0042] 1. Using the cDNA obtained in Example 1 as a template, use PI-F and PI-R as primers to carry out PCR amplification to obtain a PCR amplification product.

[0043] PI-F (forward primer): 5'- TAATACGACTCACTATAGGGAGA CAGTCCTCCGAACAGGAATCGTACAG-3'

[0044] PI-R (reverse primer): 5'- TAATACGACTCACTATAGGGAGA TCCTCCACAGTTTCTCTCACACAGTTTCTC-3'.

[0045]The underlined region is the T7 RNA polymerase promoter sequence.

[0046] 2. Using the GFP-containing plasmid as a template and using dsGFP-F and dsGFP-R as primers to carry out PCR amplification to obtain PCR amplification products.

[0047] dsGFP-F (forward primer): 5'- TAATACGACTCACTATAGGG CGGACT-3'

[0048] dsGFP-R (reverse primer): 5'- TAATACGACTCACTATAGGG CGATGC-3'

[0049] The underlined region is the T7 RNA polymerase promoter sequence.

...

Embodiment 3

[0054] Example 3 Microinjection and effect detection of dsPIB14 and dsGFP

[0055] 1. Preparation of brown planthopper: Take 30 females and 10 males in a cup with TN1 seedlings. After 24 hours, take out the adults. After hatching, it will be a fourth instar nymph after 20 days, and it will be used for injection.

[0056] 2. Plate preparation: Weigh 1.5g of agar powder and add it to 100ml of water, boil it, pour it into a glass plate, and wait for it to solidify for later use.

[0057] 3. Injection: Take 5-8 worms with similar growth in the test tube, and inject CO 2 Anesthetized for 20s. The worms were then poured onto a 1.5% agar powder plate with the abdomen facing up. Injection was performed with Nanoliter2010 microinjector according to the instructions. The injection site is between the front and middle chest. The injection volume was 46 nl (5 μg / μL).

[0058] 4. After the brown planthopper was injected with dsRNA, samples were taken from the first day after the inje...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of genetic engineering, in particular to application of a brown planthopper PIB14 protein and a coding gene thereof to regulation and control of brown planthopper resistance of plants. According to the invention, the brown planthopper PIB14 protein and a sequence of the coding gene thereof are found, and the gene has the great significance for regulating and controlling the resistance of plants to brown planthoppers and regulating and controlling the growth of the brown planthoppers. The viability of the brown planthopper can be effectively reduced by inhibiting expression of the PIB14 gene in the brown planthopper, the resistance of the plants to the brown planthopper can be effectively improved by overexpressing the PIB14 gene in the plants, and the brown planthopper PIB14 protein and the coding gene thereof found by the invention have very good application prospect, and have high application value of reducing the use of pesticides and maintaining ecological balance and sustainable development.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the application of brown planthopper PIB14 protein and its coding gene in regulating plant resistance to brown planthopper. Background technique [0002] Brown planthopper (BPH; Nilaparvata lugens Stal.), belonging to the family Homoptera (Delphacidae) of the order Homoptera, is one of the main pests on rice. The brown planthopper has the habit of long-distance migration and is a monophagous pest. It can only feed and reproduce on rice and common wild rice. The piercing-sucking mouthparts of the brown planthopper can penetrate the plant and suck the phloem juice. The brown planthopper not only feeds on the phloem sap and causes direct damage, but also causes indirect damage as a medium for the transmission of grassy dwarf disease and leaf dwarf disease. Brown planthopper feeding on rice before tillering stage will reduce the number of spikes and grains of rice; whil...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/113A01K67/033
CPCC07K14/43563C12N15/113A01K67/0339
Inventor何光存王卉颖杜波杨远柱陈荣智祝莉莉秦鹏王凯邓钊
OwnerWUHAN UNIV