Lymantria dispar linnaeus CYP6B53 gene dsRNA and application thereof in nuisanceless control

A technology of gypsy moth and gene, applied in the field of application in the control of Asian gypsy moth

Inactive Publication Date: 2015-04-29
NORTHEAST FORESTRY UNIVERSITY
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there is no report about controlling the important forest pest gypsy moth and improving its sensitivity to organophosphorus insecticides by inhibiting the transcription level of cytochrome CYPB53 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lymantria dispar linnaeus CYP6B53 gene dsRNA and application thereof in nuisanceless control
  • Lymantria dispar linnaeus CYP6B53 gene dsRNA and application thereof in nuisanceless control
  • Lymantria dispar linnaeus CYP6B53 gene dsRNA and application thereof in nuisanceless control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 : Gypsy moth cytochrome CYP6B53 Gene full-length cloning

[0027] The gypsy moth cytochrome CYP6B53 gene has a nucleic acid sequence of 1728 bp (SEQ ID No.1), an open reading frame of 1518 bp, encoding 506 amino acids (sequence shown in SEQ ID No.2), a molecular weight of 57.72 kDa, and a theoretical isoelectric point PI is 8.76, which is a basic protein.

[0028] Total RNA was extracted from Gypsy moth, using the reverse transcription kit PrimeScript TM RT reagent Kit (TaKaRa) synthesized the first strand of cDNA, and used the first strand of cDNA as a template to design primers on both sides of the gene coding region sequence according to the transcriptome sequence of gypsy moth larvae (forward primer: 5'- ATGTTGTCAATTTATTTACCTATATTTCTCATAGTAGC -3' ; reverse primer: 5'-ATTTGAAGATTTCCTCGGAACAAGTCTTACGTGAATCCCC-3'). Reaction system: 5×PrimeScript buffer 2 μL, PrimeScript RT Enzyme Mix I 0.5 μL, Oligo d(T) primer (50 μM) 0.5 μL, Random 6 mers (100 μM...

Embodiment 2

[0029] Example 2 : Gypsy moth CYP6B53 Gene dsRNA Synthesis

[0030] According to the full length of CYP6B53 gene of Gypsy moth cloned in Example 1, design and synthesize CYP6B53 gene dsRNA forward primer (5'- ATGTTGTCAATTTATTTACCTATATTTCTCATAGTAGC -3') and reverse primer (5'- ATTTGAAGATTTCCTCGGAACAAGTCTTACGTGAATCCC -3') to amplify the fragment The length of the sequence is 594 bp, and the dsRNA of the CYP6B53 gene is obtained through an in vitro dsRNA synthesis kit.

[0031] The specific synthesis process is that a 20 bp T7 promoter sequence is added to the 5' end of each specific primer, and GFP is used as a control group. The target band was amplified by PCR, and the reaction program was: 94°C for 3 min; 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 7 min, and the amplified product was confirmed by electrophoresis. Synthesize dsRNA as a template (refer to the MEGAscript RNAi Kit kit instructions), detect the concentration of dsRNA with a UV ...

Embodiment 3

[0032] Example 3 : Gypsy moth CYP6B53 Detection of gene silencing effects

[0033] The dsRNA (1 μg) of the CYP6B53 gene and GFP gene synthesized in Example 2 was microinjected into the 3rd instar larvae of the gypsy moth, and the lively 3rd instar larvae were selected at 6, 24, 48, 96, and 144 h respectively, and the RNeasy Mini animal was used to Tissue Total RNA Extraction Kit (Qiagen) was used to extract total RNA using PrimeScript TM The RT kit (TaKaRa) synthesized the first strand of cDNA, which was used as a template, and the expression level of CYP6B53 gene after injection was detected by fluorescent quantitative RT-PCR. The expression level of CYP6B53 gene in 3rd instar larvae injected with dsRNA was as follows: figure 2 As shown, the results indicated that the injection of dsRNA of exogenous control gene GFP into gypsy moth larvae would affect the expression of CYP6B53 gene. Compared with the control GFP gene, the CYP6B53 gene silencing effect was higher t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses lymantria dispar linnaeus CYP6B53 gene dsRNA and application thereof in nuisanceless control. The dsRNA sequence is shown by SEQ ID NO.3, and can be applied to inhibition of the growth and development of lymantria dispar linnaeus or improvement of the sensitivity of the lymantria dispar linnaeus to an organic phosphorus insecticide. An experimental result shows that after the CYP6B53 gene dsRNA is injected into a lymantria dispar linnaeus larva, compared with a contrast (injected with ddH2O and GFP gene dsRNA), a relatively strong silencing effect is achieved, so that the growth and development of the lymantria dispar linnaeus larva are inhibited and then the lymantria dispar linnaeus larva dies. Therefore, the invention provides a silencing technology capable of using CYP6B53 to control an important forest pest, namely the lymantria dispar linnaeus and lepidopterous pests with similar structural domains, thereby providing a new train of thought and a new technology for green control of forest pests.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to cytochrome P450 CYP6B53 gene dsRNA of Asian gypsy moth and its application in preventing and treating Asian gypsy moth. Background technique [0002] Gypsy moth ( Lymantria dispar Linnaeus) is a worldwide pest with wide distribution and miscellaneous feeding habits. According to foreign reports, it can harm more than 300 kinds of plants, and domestic reports can harm more than 500 kinds of plants such as poplar, willow, apple, sylvestris sylvestris, and larch. Gypsy moth spreads quickly, reproduces and eats a lot, causing significant economic losses to forestry production. At present, the control of Asian gypsy moth is still dominated by chemical insecticides, but these compounds are likely to cause the formation of pest resistance and environmental pollution issues. Although some natural enemies of pests, pathogenic microorganisms and other biological control have pl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/89A01N57/16A01P7/04
Inventor曹传旺孙丽丽高彩球王志英张健邹传山
OwnerNORTHEAST FORESTRY UNIVERSITY