Brown planthopper N1MLP gene, encoded protein and application of brown planthopper NIMLP

A technology of gene coding and brown planthopper, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of human and animal harm, environmental pollution, etc., and achieve the effect of reducing the use of pesticides, good application prospects, maintaining ecological balance and sustainable development

Active Publication Date: 2017-05-31
WUHAN UNIV
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, insecticides are generally used to control brown planthoppers, but with the large-scale use of insecticides, brown planthoppers have developed resistance, such as methipex, carbofuran, propmetpine, and even synthetic pyrethrins (Nagata, 1982; Lakshmi et al., 2010)
And spraying pesticides is not only harmful to humans and animals, but also causes serious environmental pollution.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brown planthopper N1MLP gene, encoded protein and application of brown planthopper NIMLP
  • Brown planthopper N1MLP gene, encoded protein and application of brown planthopper NIMLP
  • Brown planthopper N1MLP gene, encoded protein and application of brown planthopper NIMLP

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] [Example 1] Cloning of the NlMLP gene of the brown planthopper

[0055] Total RNA was extracted from 20 brown planthoppers of biotype 1 and reversed to cDNA. Primers were designed based on this sequence, and the 5' and 3' end sequences of the candidate gene were obtained using TaKaRa's 5' and 3' FμL1 RACE kit, the transcription start site and termination site of the candidate gene were determined, and spliced The full-length cDNA sequence of the gene was obtained. Re-synthesize primers MLP-F, MLP-R according to the full-length cDNA sequence, amplify the full-length cDNA of N1MLP, predict ORF, and its ORF sequence is as shown in the sequence table SEQ ID NO.1 ( figure 1 ).

[0056] MLP-F: ATGAGGTGTTTCTCAGTTATCGC

[0057] MLP-R: TCAGTAGTATCCACCAAAAACCA

Embodiment 2

[0058] [Example 2] Preparation of the dsRNA (dsMLP) for silencing the NlMLP gene of the brown planthopper and the green fluorescent protein GFP gene dsGFP for the control

[0059] 1. Take the cDNA obtained in Example 1 as a template, and use MU-F and MU-R as primers to carry out PCR amplification to obtain a PCR amplification product.

[0060] MU-F (forward primer):

[0061] TAATACGACTCACTATAGGGAGA AGCCGATGTATTTCCTGTAGAT

[0062] MU-R (reverse primer):

[0063] TAATACGACTCACTATAGGGAGA CTACAGCAGTGTCTTCAGCCAG

[0064] The underlined region is the T7 RNA polymerase promoter sequence.

[0065] 2. Use the existing GFP-containing plasmid in the laboratory as a template, and use dsGFP-F and dsGFP-R as primers for PCR amplification to obtain PCR amplification products.

[0066] dsGFP-F (forward primer): TAATACGACTCACTATAGGG CGGACT

[0067] dsGFP-R (reverse primer): TAATACGACTCACTATAGGG CGATGC

[0068] The underlined region is the T7 RNA polymerase promoter sequence.

[...

Embodiment 3

[0073] [Example 3] Microinjection and effect detection of dsMLP and dsRNA

[0074] 1. Preparation of brown planthopper: Take 30 females and 10 males in a cup with TN1 seedlings. After 24 hours, take out the adults. After hatching, it will be a fourth instar nymph after 20 days, and it will be used for injection.

[0075] 2. Plate preparation: Weigh 1.5g of agar powder and add it to 100ml of water, boil it, pour it into a glass plate, and wait for it to solidify for later use.

[0076] 3. Injection: Take 5-8 worms with similar growth in the test tube, and inject CO 2 Anesthetize for 20 seconds, do not blow on the insects when injecting CO2, to avoid collision damage caused by insects flying around. The worms were then poured onto a 1.5% agar powder plate with the abdomen facing up. Injection was performed with a Nanoliter 2010 microinjector according to the instructions. The injection site is between the front and middle chest. The injection volume was 46 nl (5 μg / μL).

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a brown planthopper sialaden secretor gene N1MLP and an application OF brown planthopper NIMLP in paddy resisting against brown planthopper after the gene N1MLP is restrained. A complete cDNA sequence of the brown planthopper sialaden secretor gene N1MLP is shown as SEQ ID No.1; ds RNA of the N1MLP enters the brown planthopper in the manner of micro-injection, so that the N1MLP gene expression quantity is reduced, the feeding of the brown planthopper is affected and the survival rate of the brown planthopper is reduced; the ds RNA of the N1MLP is stably expressed in the paddy plant; after the brown planthopper eats the paddy, the N1MLP gene expression quantity is reduced, so that the brown planthopper weight is reduced and the survival rate of the brown planthopper is reduced. According to the invention, the N1MLP, of which the expression is restrained, has significance in researching the paddy resisting against brown planthopper and preventing and treating the brown planthopper in agricultural production.

Description

technical field [0001] The present invention relates to the field of biotechnology. It specifically relates to the application of the brown planthopper NIMLP gene, its dsRNA and the RNA interference targeting the gene in controlling the brown planthopper. Background technique [0002] Brown planthopper (BPH; Nilaparvata lugens ), belonging to the Homoptera planthopper family (Homoptera; Delphacidae), is the primary pest of rice in my country and many Asian countries. The brown planthopper has the habit of long-distance migration and is a monophagous pest. It can only feed and reproduce on rice and common wild rice. The piercing-sucking mouthparts of the brown planthopper can penetrate the plant and suck the phloem juice. The brown planthopper not only feeds on the phloem sap and causes direct damage, but also causes indirect damage as a medium for the transmission of grassy dwarf disease and leaf dwarf disease. Brown planthopper feeding on rice before tillering stage wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/113C07K14/435A01N57/16A01P7/04
CPCA01N57/16C07K14/43563C12N2310/14
Inventor何光存上官欣欣杜波陈荣智祝莉莉
OwnerWUHAN UNIV