Unlock instant, AI-driven research and patent intelligence for your innovation.

A soybean protein gmidd affecting plant growth period and its coding gene and application

A soybean protein and growth period technology, applied in the field of genetic engineering, can solve the problems of long breeding cycle, soybean photoperiod sensitivity, strong parental dependence, etc., and achieve the effect of reducing photoperiod sensitivity

Inactive Publication Date: 2018-08-10
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional method to solve the problem of soybean photoperiod sensitivity is to obtain new soybean varieties through hybridization, but this method has the disadvantages of strong dependence on parents and long breeding cycle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A soybean protein gmidd affecting plant growth period and its coding gene and application
  • A soybean protein gmidd affecting plant growth period and its coding gene and application
  • A soybean protein gmidd affecting plant growth period and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Cloning of Transcription Factor GmIDD Gene in Example 1 Soybean Photoperiod Signal Transduction Pathway

[0040] The short-day-induced soybean EST was screened by using the inventor's previous soybean inhibitory subtractive cDNA library, compared with the soybean genome database, numbered Glyma14g10940, named GmIDD, (Genbank accession number KT266576), and primers were designed according to the sequence mRNA , Soybean extracted with Trizol reagent (Glycine max, Dongnong 42; Chen Lijun, Study on the dynamic change law of soybean Dongnong 42 yield and quality traits at different sowing dates, [J]. Soybean Science, 2008, (03). Publicly available from Northeast Agricultural University Obtain) leaf total RNA, reverse transcribe the first strand of synthetic cDNA as a template, carry out PCR to clone the gene, the result is consistent with the sequence on the Internet, obtain the 1468bp mRNA sequence of ORF, the ORF is 1227bp, encodes 408 amino acids, and the sequence in the s...

Embodiment 2

[0041] Example 2 Acquisition and Functional Research of Transgenic GmIDD Arabidopsis

[0042] 1. Construction of plant expression vector pCAMBIA3300+pBI121-GmIDD

[0043] Trizol reagent was used to extract the total RNA of soybean Dongnong 42, and the first strand of cDNA was synthesized by reverse transcription as a template, with a sense primer: GC TCTAGA ATATGTCCAATTTGACGTCTGC (the underlined part is the XbaI restriction site), antisense primer: GC GAGCTCGCTTTTATTCCCTGATCAAGATG (the underlined part is the Sac I restriction site), perform PCR reaction, the PCR condition is 94°C for 5min; 35 cycles: 94°C for 30s, 56°C for 30s, 72°C for 1.5min; 72°C for 10min. The PCR product was detected by electrophoresis on 0.8% agarose gel, and the result showed that the PCR product was 1277bp. The ORF of sequence 1 in the sequence listing is 82-1308 nucleotides, encoding the protein shown in sequence 2 in the sequence listing, and the protein is named GmIDD.

[0044] The intermediate...

Embodiment 3

[0064] Example 3 Expression analysis of soybean GmIDD gene

[0065] 1. Expression analysis of soybean GmIDD gene in different days

[0066] Plant Dongnong 42 seeds in flower pots, one seed per pot. Cultivate at 25°C under the condition of long day (LD) until the second three compound leaves are fully unfolded. Soybean seedlings with consistent growth were selected, and some of them were treated with long-day light and the other part with short-day (SD) treatment. At 15, 17, 20, 23, 26, 29, 32, 35, and 45 days after the start of light, three compound leaves were taken to extract RNA, and reverse transcription was performed for quantitative fluorescent PCR. The result is as Figure 11 As shown, the results showed that soybean GmIDD was induced by short-day, and the expression abundance of soybean GmIDD gene in short-day (SD) was significantly higher than that in long-day (LD) conditions from day 23 onwards.

[0067] 2. Response of soybean GmIDD gene to the change of length a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses soybean protein GmIDD influencing plant growth period as well as an encoding gene and application thereof, and belongs to the technical field of gene engineering. The amino acid sequence of the soybean protein GmIDD is shown in the SEQ ID NO.1 (in the description), and the nucleotide sequence of the protein coding gene is shown in the SEQ ID NO.1 (in the description). In addition, the invention further provides a method of application of the soybean protein GmIDD to promotion of plant flowering and adjustment of plant growth period. The soybean protein GmIDD provided by the invention, can be used for solving the problem of flowering asynchronism in crossbreeding, the problem about the control in the growth periods of various crops, vegetables, fruits, flowers and plants, the problem about photoperiod sensitivity, and the introducing problem.

Description

technical field [0001] The invention relates to a soybean protein GmIDD that affects the growth period of plants, its encoding gene and its application, and belongs to the technical field of genetic engineering. Background technique [0002] Soybean is a short-day (SD) plant, which is very sensitive to photoperiod response, especially the strict control of flowering and harvesting photoperiod. This characteristic seriously hinders the adaptability of soybean varieties, resulting in the inability of excellent soybean varieties in different regions to reflect each other. Severely limit the sowing range of soybeans and affect the effective performance of the yield level. The flowering time and maturity period of soybean are important agronomic traits that control the yield, quality and adaptability of soybean varieties. How to reduce the sensitivity of soybean to photoperiod and break through the limitation of photoperiod on soybean flowering can solve the problem of soybean i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/84C12N5/10A01H5/00A01H6/20
CPCC07K14/415C12N15/827
Inventor 赵琳李文滨吕庆雪杨雪
Owner NORTHEAST AGRICULTURAL UNIVERSITY