Application of gene GmRAV1 related to photoperiod adjusting and controlling of soybean

A gene, soybean technology, applied in the field of plant genetic engineering

Inactive Publication Date: 2017-03-22
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is a lack of methods that can effectively control the plant type in the prior art.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gene GmRAV1 related to photoperiod adjusting and controlling of soybean
  • Application of gene GmRAV1 related to photoperiod adjusting and controlling of soybean
  • Application of gene GmRAV1 related to photoperiod adjusting and controlling of soybean

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1: Cloning and sequence analysis of the GmRAV1 gene

[0058] cDNA was obtained by reverse transcription using soybean leaf transcribed RNA as a template, and the cDNA was used as a PCR reaction template to obtain the gene DNA sequence of the full-length ORF region. The complete DNA sequence of the GmRAV1 transcription factor deduced from the soybean is 1757bp, the ORF is 1155bp, encoding 384 amino acids, containing the AP2 / B3 domain (see the 270th-1421st position in the sequence table SEQ ID NO.1), and the sequence is in the plant genome database The accession number of phytozome (URL: https: / / phytozome.jgi.doe.gov / pz / portal.html) is Glyma01g22260.1. Homologous sequence comparison found ( figure 1 ), the sequence has 50.20% and 42.34% homology with phaseolus vulgaris (XM_007143739) and Medicago truncatula (XM_003591774) RAV1, and 47.07% homology with maize (Zea mays) (NM_001148270).

Embodiment 2

[0059] Example 2: Real-time RT-PCR analysis of the effects of day length and circadian rhythm on GmRAV1 gene expression

[0060] Soybean DN42 was cultivated in a light incubator at 25°C, 250mol m -2 sec -1 White light, grow under long-day (16h / 8h light / dark) (LD) conditions and grow on the 20th day after emergence (determined as 0d), part of it is transferred to short-day (SD) photoperiod (8h / 16h light / dark) growth, At 0, 3, 6, 9, 12, 15, 18, 21, and 24 days after transfer, LD and SD leaves were collected simultaneously, quick-frozen in liquid nitrogen, stored at -80°C, and RNA was extracted. According to SYBR(R)ExScriptTM RT- The program of PCR Kit is used to carry out the fluorescence quantitative PCR reaction. The amplified fragment of GmRAV1 is 144bp, and the amplified fragment of the soybean housekeeping gene Actin4 (AF049106) is 214bp. The primers are as follows: GmRAV1 sense primer: GGTGTAGTGGCATAGTGGC, antisense primer:

[0061] TAAGAAGGGGAGAAGCTAGA; Actin4 sense pr...

Embodiment 3

[0062] Example 3: Construction of plant expression vector pCAMBIA3301-GmRAV1, transformation of soybean cotyledon nodes by Agrobacterium-mediated transformation and transformation of Arabidopsis thaliana by tidbit infection method

[0063] cDNA was obtained by reverse transcription using soybean leaf transcribed RNA as a template, and the cDNA was used as a PCR reaction template to obtain the gene DNA sequence of the full-length ORF region. The complete DNA sequence of GmRAV1 transcription factor inferred from the soybean is 1757bp, and the ORF is 1155bp. Using Bgl II and BstE II as restriction sites, design cloning primers, and perform PCR reaction at 94°C for 5min; 38 cycles: 94°C for 30s , 58°C for 30s, 72°C for 1min; 72°C for 10min; PCR products were subjected to 1% agarose gel electrophoresis, DNA fragments were recovered according to the instructions of the OMEGA GelExtraction Kit, and TaKaRa’s pMD18-T vector was used for ligation. The molar ratio of the gene and the con...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a gene GmRAV1 related to photoperiod adjusting and controlling of a soybean, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the soybean gene GmRAV1 is shown in SEQ ID NO.1, encoded protein is shown in SEQ ID NO.2. The soybean gene GmRAV1 can be used in processes of adjusting plant photoperiod sensitivity and promoting shoot regeneration in plants. By overexpressing the gene GmRAV1 of the soybean, shoot regeneration in plants is promoted; meanwhile, by silencing and interfering the expression of the gene GmRAV1 of the soybean, plant photoperiod sensitivity, plant height, bloom maturation period are changed, and the plant photoperiod sensitivity is lowered. The gene GmRAV1 of soybean can be applicable to cultivation and improvement of a new eurytopicity product with precocity and photoperiod insensitivity, solve the problem of flowering asynchronism in crossbreeding, breeding period controlling problem, photoperiod sensitivity problem and introduction problem of various crops, vegetables, fruit, and flowers.

Description

technical field [0001] The invention relates to the application of a gene GmRAV1 related to soybean photoperiod regulation, and belongs to the technical field of plant genetic engineering. Background technique [0002] Generally speaking, the growth and development of short-day plants such as soybeans and rice are very sensitive to photoperiod responses. This characteristic seriously hinders the adaptability of soybean varieties, limits the sowing range of soybeans, and affects the effective production level. Generally, shortening the sunshine time promotes the flowering of plants such as soybeans and rice, and shortens the growth period. On the contrary, increasing the sunshine time inhibits soybean flowering and prolongs the growth period. Therefore, the introduction from north to south (sunshine time from long to short during the growth period) will accelerate maturation, shorten the growth period, reduce yield, and limit the performance of yield traits. On the contrary...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82A01H5/00
CPCC07K14/415C12N15/8218C12N15/8261
Inventor李文滨赵琳张可欣
OwnerNORTHEAST AGRICULTURAL UNIVERSITY