Aptamer-modified dna origami nanostructure-nanogold biosensor and its preparation method and application

A biosensor, nanostructured technology for detection and analysis to achieve precise spatial addressability, cost reduction, and avoidance of labeling steps

Active Publication Date: 2018-05-11
SOUTHWEST UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there are no research and patent reports on the use of gold nanoparticles for small molecule detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Aptamer-modified dna origami nanostructure-nanogold biosensor and its preparation method and application
  • Aptamer-modified dna origami nanostructure-nanogold biosensor and its preparation method and application
  • Aptamer-modified dna origami nanostructure-nanogold biosensor and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1 Preparation of equilateral triangle DNA origami

[0032] According to the sequence designed by Rothemund (P.W.Rothemund, Nature, 2006, 440, 297.0), the M13mp18 phage (purchased from NEB Company, item number: #N4040S), more than 200 unmodified staple chains (P.W. Rothemund, Nature, 2006, 440, 297.0 ), the staple chain (SEQ ID No.1) modified with aflatoxin aptamer at the end was mixed according to the molar ratio of 1:10:10, and then 1×TAE~Mg 2+ Buffer (Mg 2+ After the concentration of 12.5mM), the mixed solution was placed in a PCR instrument and annealed from 95°C to 20°C at a rate of 1°C / 100s. After the reaction, a 100kDa ultrafiltration tube (Amicon Ultra Company) was used to remove excess staple chains and then put into Next use.

[0033] Wherein, the staple chain sequence with the aflatoxin aptamer modified at the end is as follows:

[0034] 5'-gttgggcacg tgttgtctctctgtgtctcg tgcccttcgc taggcccact ttttgtgagaaaatgtgtag gtaaagatac aacttt-3', (SEQ ID No...

Embodiment 2

[0035] Example 2 Preparation of SH-DNA modified gold nanoparticles

[0036] BSPP (bis(p-sulfonatophenyl)phenylphosphine dihydrate dipotassiumsalt, purchased from Sigma-Aldrich Company) was used to modify gold nanoparticles, using the method reported by Ding Baoquan (B.Q.Ding, Z.T.Deng, H.Yan, S.Cabrini, R.N.Zuckermann, J.Bokor , J.AM.CHEM.SOC,2010,132,3248): 15mg BSPP was added to 50mL nano-gold solution with a concentration of 1.67nM, and after shaking in the dark at room temperature for 12h, solid sodium chloride was added until the color of the solution became light Purple color, centrifuge at 10,000rpm for 15min, discard the supernatant, resuspend the pellet in 1mL of 2.5mM BSPP solution, add 1mL of methanol, and centrifuge again to collect the pellet and resuspend in BSPP. The UV-Vis spectrophotometer, particle size, and zeta potential characterization results before and after nano-gold modification are shown in figure 1 , it can be seen that after each step of modifica...

Embodiment 3

[0040] Example 3 Feasibility experiment of aflatoxin B1 detection based on aptamer-modified DNA origami nanostructure-nanogold biosensor

[0041] Firstly, the DNA origami with the aflatoxin aptamer is specifically reacted with the aflatoxin: the DNA origami with the aflatoxin aptamer is mixed with excess aflatoxin at a molar ratio of 1:100 , react at room temperature for 30 minutes, take the newly dissociated mica flakes, drop into 10 μL of the above-mentioned mixture after the reaction, and use the ScanAsyst mode to perform characterization with an atomic force microscope (Bruker DIMENSION icon) after drying. The characterization results are as follows figure 2 It is shown in figure b1 in middle.

[0042] Then hybridize the DNA origami connected with the aflatoxin aptamer and the gold nanoparticles modified with complementary DNA at a molar ratio of 1:5, put it into a PCR instrument for gradient annealing at 43°C-20°C, and take a new solution 10 μL of the reacted above-ment...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a DNA flexagon nano structure-nanogold biosensor based on adapter modification and a preparing method and application of the DNA flexagon nano structure-nanogold biosensor. The biosensor comprises DNA flexagon and nanogold, the DNA flexagon comprises an adapter nucleotide sequence of a detected object, and the nanogold is nanogold modified by a DNA fragment complementary with the adapter nucleotide sequence. The method includes the following beneficial effects that the DNA flexagon has the accurate space addressability, and the complicated marking step is avoided after the nanogold is added; an adapter can be synthesized in batch with a chemical method, so that the cost is greatly reduced; the shortcoming that the autoimmunity of micromolecule matter is poor is overcome; the DNA flexagon nano structure-nanogold biosensor has the lower detection limit, and LOD reaches the nanogram stage; an atomic force microscope and electrophoresis are adopted for conducting representation, qualitative and quantitative analysis is carried out by using the characteristic that the nanogold is high in light in an atomic force microscope height map; and compared with a traditional survey method, the advantages of being easy and convenient, reliable, lower in requirement for experiment conditions and the like are achieved.

Description

technical field [0001] The invention belongs to the field of detection and analysis, and in particular relates to a biosensor based on an aptamer-modified DNA origami nanostructure-nanogold and its preparation method and application. Background technique [0002] In 2006, Rothemund reported a very innovative bottom-up self-assembly method: a long scaffold chain and more than 200 staple chains were assembled into a two-dimensional figure through base complementarity, called DNA origami. Its outstanding advantages such as simple reaction process, fast response and high yield have pushed the development of DNA nanotechnology to a new peak. It has been widely used in biosensing, material detection, single-molecule level analysis, disease diagnosis and treatment. and other fields. [0003] Aptamers are a class of 20-60 nt single-stranded oligonucleotide sequences screened by SELEX technology, which can specifically bind to target substances. They can be RNA or single-stranded DN...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6813
CPCC12Q1/6825C12Q2563/137C12Q2563/155
Inventor鲁志松王瑛
OwnerSOUTHWEST UNIV