Polypeptide having binding affinity to HPV16 E7 and application thereof

An affinity and polynucleotide technology, applied in the field of peptides, can solve problems such as low immune function, limited effect of therapeutic vaccines, bone marrow suppression, etc.

Active Publication Date: 2016-08-17
WENZHOU MEDICAL UNIV
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the prior art, although the cervical cancer preventive vaccine based on HPV L1 protein has been commercialized, the therapeutic vaccine based on HPV and its E7 is still in the stage of experimental research and exploration
However, the existing problem is that the role of therapeutic vaccines is based on the immune function of the body, using tumor-specific antigens or epitopes to stimulate a stronger anti-tumor-specific immune effect to achieve the purpose of eliminating tumor cells; but Tumor patients often have low autoimmune function, or immunosuppression or immune escape, so that the therapeutic vaccine has limited effect, and it is difficult to achieve the expected therapeutic purpose
Radioimmunotherapy with isotope-labeled antibodies also leads to myelosuppression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptide having binding affinity to HPV16 E7 and application thereof
  • Polypeptide having binding affinity to HPV16 E7 and application thereof
  • Polypeptide having binding affinity to HPV16 E7 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0130] Example 1. Library Construction and Screening Research of HPV16E7 Binding Polypeptides

[0131] A random combinatorial library of phage displaying HPV16 E7-binding polypeptides was constructed, that is, a library of many different SPA domain-related polypeptides, and HPV16 E7-binding polypeptides were screened from the library, and their affinity was identified.

[0132] 1. Construction and identification of a random combinatorial phage display library of HPV16 E7-binding peptides

[0133] According to the amino acid sequence and structure of wild-type SPA-Z (Nilsson B et al., Protein Eng.1987; 1 (2): 107-113), random primers were designed for the coding sequences corresponding to its three helical structural regions, and amplified by PCR. A SPA coding sequence that can lead to random amino acid mutations was added and named SPA-N.

[0134] 2. Construction of pCANTAB5E / SPA-N recombinant plasmid

[0135] The M13 phage system (purchased from Beijing Baokewei Food Safety...

Embodiment 2

[0146] Example 2, HPV16E7 binding polypeptide recombinant plasmid construction and prokaryotic protein expression and purification

[0147] Four clones with higher ELISA reads were selected as before ( figure 1 affibody Z in HPV16 E7:127 ,Z HPV16 E7:301 ,Z HPV16 E7:384 ,Z HPV16 E7:745 ), in order to perform functional testing on the screened affibody molecules, construct recombinant plasmids, express and identify prokaryotic proteins, and prepare purified proteins.

[0148] 1. Construction and identification of recombinant plasmid of pET21a(+) / affibody

[0149] Design PCR primers with reference to the affibody gene sequence (GenBank: GY324633.1), upstream primer 5'GGGAATTC CATATG GTTGACAACAAATTCAACAAAGAA 3' (SEQ ID NO: 13, the underline indicates the Ned I restriction site), downstream primer 5' CCG GAATTC CGTTTCGGAGCCTGAGCGT3' (SEQ ID NO: 14, the underline indicates the XhoI restriction site); the single clone affibody Z of the quaternary library with the correct ...

Embodiment 3

[0153] Example 3, Z HPV16 E7 Binding of affibody polypeptide to HPV16 E7 protein

[0154] To identify Z HPV16 E7 The binding specificity of affibody polypeptide to HPV16 E7 protein, using surface plasmon resonance (SPR) to analyze and screen four Z HPV16 E7:127 ,Z HPV16 E7:301 ,Z HPV16 E7:384 ,Z HPV16 E7:745 Molecule and its control Z wt Specific binding of affibody to target protein HPV16 E7.

[0155] Preparation of HPV16 E7 protein: amplify HPV16 E7 gene from cervical cancer tissue by PCR method, clone into pET21a(+) vector, construct pET21a(+) / HPV16 E7 recombinant plasmid, and sequence identification; transform the recombinant plasmid into Escherichia coli BL21(DE3), expressed recombinant protein after IPTG induction, was purified by Ni-NTA affinity chromatography and identified by SDS-PAGE and Western blot analysis (see Wang Bingbing et al., Expression of HPV16 type E7 recombinant protein and its polyclonal antibody Preparation; Journal of Cellular and Mole...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention relates to polypeptide having binding affinity to HPV16 E7 and an application thereof. The invention firstly reveals the polypeptide having binding affinity to E7protein of HPV16. The invention also provides diagnosis or treatment purposes of the polypeptide as a medicine or a molecular targeted agent.

Description

technical field [0001] The present invention relates to the field of biomedicine, more specifically, the present invention relates to a polypeptide with binding affinity to HPV16 E7 and its application. Background technique [0002] Cervical cancer is a globally recognized cancer mainly associated with human papillomavirus (HPV) infection, and its mortality rate ranks second among cancers in women worldwide. In the prior art, although the cervical cancer preventive vaccine based on HPV L1 protein has been commercialized, the therapeutic vaccine based on HPV and its E7 is still in the stage of experimental research and exploration. However, the existing problem is that the role of therapeutic vaccines is based on the immune function of the body, using tumor-specific antigens or epitopes to stimulate a stronger anti-tumor-specific immune effect to achieve the purpose of eliminating tumor cells; but Tumor patients often have low autoimmune function, or immunosuppression or imm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/31C12N15/31C12N15/63C12P21/02A61K39/085A61P35/00G01N33/68
Inventor 张丽芳薛向阳朱珊丽王乐丹朱冠保李文姝
Owner WENZHOU MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap