A kind of human anti-vegfr2 antibody and its application
A technology of growth factor receptors and heavy chains, applied in the fields of application, anti-tumor drugs, anti-growth factor immunoglobulins, etc., can solve the problems such as the complex molecular regulation mechanism of tumor angiogenesis, and achieve the effect of great application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1, Discovery of VEGFR2 specific antibody
[0037] 1. Establishment of human monoclonal antibody library
[0038] Peripheral blood was obtained from 30 volunteers who gave informed consent, and lymphocytes were isolated and total RNA was extracted. Total RNA was reverse transcribed to obtain cDNA. Using cDNA as a template, the variable regions (VH and VL) of the antibody heavy and light chains were amplified by PCR using degenerate primers. The PCR products were subjected to 1% agarose gel electrophoresis, and VH DNA and VL DNA were recovered, and were ligated into a single-chain antibody (scFv) gene by overlapping PCR. The single-chain antibody genes from different volunteers were mixed in equal amounts, grouped and cut with endonucleases, and then subjected to 1% agarose gel electrophoresis, and the DNA fragments were recovered and connected to phagemid vectors that had been cut with the same endonucleases Plasmid, the ligated phagemid carrier plasmid was tr...
Embodiment 2
[0044] Embodiment 2, the acquisition of recombinant cells
[0045] 1. Construction of recombinant plasmids
[0046] 1. Synthesize a DNA molecule (double-stranded DNA molecule shown in sequence 2 of the sequence listing) encoding the heavy chain of the VEGFR2 specific antibody and use it as a template, and use a primer pair consisting of H-F and H-R to carry out PCR amplification to obtain PCR amplification product.
[0047] H-F: GGCAAA GAATTC GCCGCCACC ATGGAACTGGGGCTCCGCTG;
[0048] H-R: GAGCTC GAATTC CTATTTACCCGGAGACAGGGAG.
[0049] 2. Digest the PCR amplified product obtained in step 1 with restriction endonuclease EcoR I, and recover the digested product.
[0050] 3. Digest the pCMV-Myc plasmid with restriction endonuclease EcoR I, and reclaim the vector backbone.
[0051] 4. Ligate the digested product of step 2 with the vector backbone of step 3 to obtain recombinant plasmid pCMV-H.
[0052] 5. Synthesize a DNA molecule encoding the light chain of the VEGFR2 specif...
Embodiment 3
[0063] Example 3, Large-scale preparation and purification of VEGFR2 specific antibody
[0064] CD07V4 medium: the product of Shanghai Opmai Company. PFF06 feed medium: the product of Shanghai Optimai Company. The full name of MTX is methotrexate.
[0065] 1. Take the recombinant cells obtained in Example 2, inoculate them into CD07V4 medium containing 400nM MTX, and culture them with shaking at 37°C until the cell density is (2-4)×10 6 cells / ml.
[0066] 2. Using a 20-liter working volume reactor from Applikon, the Netherlands, to cultivate cells for protein production. Inoculate 2500ml of the culture system that completed step 1 into 10 liters of CD07V4 medium, and culture at 36.5±0.5°C for 15 days (during the cultivation, control the pH to 7.0±0.05; -0.05vvm, dissolved oxygen set point 40%; cell density reaches 5×10 6 cells / ml to start feeding, every 48 hours to add a volume of 5% PFF06 feeding medium of the culture system).
[0067] 3. After step 2 is completed, the ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More