A gene chip kit for detecting drug-resistant genes of Gram-negative bacteria

A Gram-negative, drug-resistant gene technology, applied in the field of nucleic acid amplification, can solve the problems of cumbersome operation, low throughput, and slow report results

Active Publication Date: 2018-07-06
PEOPLES HOSPITAL PEKING UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In clinical diagnosis, there are defects such as large dosage of antibiotics, high starting point, and relatively random types, which lead to the emergence and prevalence of drug-resistant bacteria
At present, the detection of drug resistance genes is still relatively traditional. There are generally physiological and biochemical tests, serological tests, drug sensitivity tests, etc. followed by polymerase chain reaction (PCR) methods to amplify the corresponding genes, but the above detection methods take a long time, The method is cumbersome in operation, slow in reporting results, and low in throughput, and the strains are often identified before subsequent tests such as drug susceptibility can be carried out accordingly, so it is difficult to meet the needs of clinical treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene chip kit for detecting drug-resistant genes of Gram-negative bacteria
  • A gene chip kit for detecting drug-resistant genes of Gram-negative bacteria
  • A gene chip kit for detecting drug-resistant genes of Gram-negative bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Embodiment 1, preparation and use thereof for detecting the kit of Gram-negative bacterial drug resistance gene

[0062] 1. Assembly and preparation of kits for detecting drug resistance genes of Gram-negative bacteria

[0063] 1. Primers and hybridization probes designed for 10 Gram-negative bacterial drug resistance genes

[0064] The specific sequences of primers and single-stranded hybridization probes designed for 10 Gram-negative bacterial drug resistance genes are shown in Table 1 and Table 2.

[0065] Table 1 Primers designed for 10 Gram-negative bacterial drug-resistant genes

[0066]

[0067]

[0068] Table 2 Single-stranded hybridization probes designed for 10 Gram-negative bacterial drug-resistant genes

[0069] Numbering

detection gene

GenBank

probe name

Sequence (5'-3')

1

bla DHA-1

EF406115.1

DHA-574

TTGCTGACTGCACGGATCCT (sequence 21)

2

bla OXA-23

JN665073.1

OXA23-139

CCCGAGTC...

Embodiment 2

[0091] Embodiment 2, the specificity and the sensitivity determination of the kit for detecting drug resistance gene of Gram-negative bacteria

[0092] 1. Preparation of reference DNA plasmid

[0093] 1. Contains bla DHA-1 Construction of plasmids for gene target fragments

[0094] will bla DHA-1 The DNA fragment shown at positions 1-1113 of the gene (GenBank: EF406115.1, update: 2007-8-17) was ligated to the pGEM-T Easy Vector vector (promega company product) to obtain the recombinant plasmid ZL-DHA-1. and verified by sequencing.

[0095] 2. Contains bla OXA-23 Construction of plasmids for gene target fragments

[0096] will bla OXA-23 The DNA fragment shown at positions 97-899 of the gene (GenBank: JN665073.1, update: 2011-11-7) was ligated to the pGEM-T Easy Vector vector to obtain the recombinant plasmid ZL-OXA-23. and verified by sequencing.

[0097] 3. Contains bla OXA-24 Construction of plasmids for gene target fragments

[0098] will bla OXA-24 The DNA fragm...

Embodiment 3

[0119] Embodiment 3, the detection of actual clinical sample

[0120] 1. Types of clinical samples

[0121] The clinical samples used in this example came from viscous pus from human wounds collected by Peking University People's Hospital (based on the principle of voluntariness of the collectors), a total of three samples.

[0122] 2. Extraction of DNA samples from clinical samples

[0123] 1. Take 1-3mL of clinical samples from step 1;

[0124] 2. Add 4 times the volume of 4% (4g / 100mL) NaOH, shake well, and place at room temperature for 30 minutes to liquefy;

[0125] 3. Take 0.5mL of liquefied pus and 0.5ml of 4% (4g / 100mL) NaOH, room temperature, 10min;

[0126] 4. Centrifuge at 12 000 rpm for 15 minutes;

[0127] 5. Discard the supernatant, add 1 mL of sterile saline, mix well, and centrifuge at 12 000 rpm for 5 min;

[0128] 6. Discard the supernatant, and precipitate for DNA extraction;

[0129] 7. Add 50 μL of nucleic acid extraction solution (product of Boao Bi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene chip kit for detecting gram negative bacteria drug resistance genes. The kit contains a primer pair set used for detecting the gram negative bacteria drug resistance genes, the primer pair set is composed of ten primer pairs, and the sequences of the primer pairs are sequences 1-20 as shown in the sequence table. Meanwhile, the kit further contains a hybridization chip to which ten single-stranded DNA probes as shown in sequences 21-30 are fixed. By the adoption of the kit, high-pass, quick and accurate detection of multiple gram negative bacteria drug resistance genes can be achieved so as to achieve screening of Chinese population, accurate diagnosis, drug resistance tracing and drug resistance control can be effectively achieved, and therefore usage of antibiotics is reduced and the possibility of drug resistance is reduced.

Description

technical field [0001] The invention belongs to the technical field of nucleic acid amplification, and relates to a gene chip kit for detecting drug-resistant genes of Gram-negative bacteria. Background technique [0002] Detection of bacterial drug resistance genes has important clinical significance. In clinical diagnosis, there are defects such as large dosage of antibiotics, high starting point, and relatively random types, which lead to the emergence and prevalence of drug-resistant bacteria. At present, the detection of drug resistance genes is still relatively traditional. There are generally physiological and biochemical tests, serological tests, drug sensitivity tests, etc. followed by polymerase chain reaction (PCR) methods to amplify the corresponding genes, but the above detection methods take a long time, The method is cumbersome in operation, slow in reporting results, and low in throughput, and the strains are often identified first before follow-up tests suc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/689C12Q1/6837C12Q1/04C12N15/11
CPCC12Q1/6837C12Q1/689C12Q2565/501C12Q2531/113
Inventor王辉姜可伟张岩王杉
OwnerPEOPLES HOSPITAL PEKING UNIV