Unlock instant, AI-driven research and patent intelligence for your innovation.

Escherichia coli expression system of retinol binding protein and preparation method of protein thereof

A technology for binding proteins and Escherichia coli, applied in the field of microbial molecular biology, to achieve the effects of increased existence time, improved immunogenicity, simplified and accurate process methods

Active Publication Date: 2020-07-10
北京达成生物科技有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide the construction of retinol-binding protein genetically engineered bacteria and the preparation and renaturation method of the protein. The gene encoding RBP is artificially synthesized by genetic engineering means, and the FAD synthetase gene fragment is added to the original gene fragment to construct the gene. The engineering strain can solve the problems faced by the separation and purification of retinol-binding protein from plasma in the prior art, and solve the problems in the prior art economically and effectively

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 Construction of retinol-binding protein genetically engineered bacteria expression system

[0033] 1.1 Design primers to clone retinol binding protein gene

[0034] RBPF: ATCG CCATGG ATGCTGCATCAGCCGACC;

[0035] RBPR: ATCG CTCGAGTTACTGCACTTTTTTAAACACC.

[0036] 2.2 Replicon amplification conditions

[0037] The reaction system includes 20mM (mmol / L, millimole per liter, the same below) Tris-HCl (trishydroxymethylaminomethane, pH 8.8), 10mM KCl (potassium chloride), 10mM (mol / L, mole per liter , the same below) (NH 4 ) 2 SO 4 (ammonium sulfate), 2mM MgSO 4 (Magnesium sulfate), 0.1% TritonX-100 (polyethylene glycol octyl phenyl ether), 50M dATP (adeoxynucleotide triphosphate), 50M dGTP (deoxynucleotide guanine triphosphate), 50μM ( μmol / L, micromole per liter, the same below) dTTP (thymidine triphosphate), 50 μM dCTP (cytosine triphosphate), 400nM primer SAMF (S-adenosylmethionine ), 400 nM primer SAMR, 1.5 U (unit) Pfu DNA polymerase (Promega, USA...

Embodiment 2

[0042] Embodiment 2 Fermentation preparation method of retinol binding protein

[0043] 2.1 Bacteria seed culture medium

[0044] The bacterial seed medium includes 10 g / L tryptone, 5 g / L yeast extract and 10 g / L sodium chloride. Sterilize at 121°C for 20 minutes before use, and add kanamycin sulfate after cooling to a final concentration of 50 mg / L.

[0045] 2.2 Fermentation initial medium

[0046] The fermentation initial medium includes 10g / L tryptone, 5g / L yeast extract, 6-12g / L dipotassium hydrogen phosphate, 3-6g / L sodium dihydrogen phosphate, 0.2-1g / L citric acid monohydrate, 0.2-2g / L magnesium sulfate, 1-10ml / L trace element mother solution, adjust the pH to 6.8-7.2, and sterilize at 121°C for 20min. Before inoculation, add sterilized glucose to a final concentration of 15-20 g / L, and use ammonia water to adjust the pH to 6.5-7.3. Add kanamycin sulfate to a final concentration of 50 mg / L.

[0047] Phosphate in the initial medium is calculated by volume ratio, dipo...

Embodiment 3

[0060] Example 3 Purification and renaturation of retinol binding protein

[0061] 3.1 Purification process

[0062] Adjust the pH of the fermentation broth to 7.0-8.0, and homogenate at 600-900 bar to release the target protein;

[0063] Add nuclease to the homogenate, stir well, and centrifuge at 5000g for 20min to remove most of the nucleic acid, cell debris, and some foreign proteins; then collect the precipitate;

[0064] Resuspend the pellet with 2M Urea and 50mM Tris, sonicate for 30min, centrifuge at 10000g for 30min to remove impurities, discard the supernatant and collect the pellet;

[0065] Add 1 / 5 to 1 times the original volume of 50Mm Tris and 1% Triton solution to the precipitate, stir for 30min, and centrifuge at 10000g for 30min;

[0066] The denaturing solution was 6M Urea, 50mM Tris and 2mM DTT solution, the denatured inclusion body was denatured with a denaturing solution with a volume ratio of 1:10, stirred for 2 hours, centrifuged at 10000g for 30 minut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of microbial molecular biology, and in particular, relates to an escherichia coli expression system of a retinol binding protein and a preparation method of the protein. The escherichia coli expression system of retinol binding protein genetic engineering bacteria comprises the following steps: artificially synthesizing a retinol binding protein gene linked with an FAD synthase, and obtaining an amplified gene product by a PCR reaction procedure, wherein PCR amplification primers comprise RBPF:ATCGCCATGGATGCTGCATCAGCCGACC and RBPR:ATCGCTCGAGTTACTGCACTTTTTTAAACACC; carrying out NcoI and XhoI double-enzyme digestion of the amplified gene product, and constructing the products in series onto a pET30a vector after NcoI and XhoI double-enzyme digestion, and constructing to form a retinol binding protein expression vector; and transforming the retinol binding protein expression vector to escherichia coli cells, to obtain the escherichia coli expression system of the retinol binding protein genetic engineering bacteria. The escherichia coli expression system has the beneficial effects that the problems of low yield, low purity, low renaturation rate and the like existing in the prior art can be solved, and the problems existing in the prior art can be economically and effectively solved.

Description

technical field [0001] The invention relates to the field of microbial molecular biology, in particular to an Escherichia coli expression system of a retinol-binding protein and a method for preparing the protein. Background technique [0002] The content of retinol-binding protein (RBP) in normal human urine is very small, less than 0.1 μg / min, and its increased output is considered to be a sensitive diagnostic indicator of proximal renal tubular injury. Retinol-binding protein was significantly positively correlated with urinary albumin, urinary N-acetyl-β-D-glucosaminidase (NAG), and β2-microglobulin (β2-MG). It is more stable than β2-MG in an alkaline environment, and does not decompose at 37°C (while β2-MG decomposes rapidly when the pH is below 5.5, and 80% of it will be decomposed after 2 hours at room temperature). Urinary retinol-binding protein is more sensitive than NAG as an indicator of renal tubular damage. In disease states, urinary retinol-binding protein c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/70C12N1/21C12P21/02C07K14/47C07K1/22G01N33/68C12R1/19
CPCC07K14/47C12N9/1241C12N15/70C12P21/02C12Y207/07002G01N33/6893G01N2800/02
Inventor 刘鹏飞赵占勇郑长龙
Owner 北京达成生物科技有限公司