Endo-xylanase reorganized mutant having improved salt adaptability and its preparation method and application

An endo-xylanase and mutant technology, which can be used in the fields of genetic engineering and protein modification, and can solve the problems of lack of catalytic activity and the like

Active Publication Date: 2017-07-11
YUNNAN NORMAL UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the salting-out effect at high salt concentration, most enzymes do not have good catalytic activity at high salt concentration

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Endo-xylanase reorganized mutant having improved salt adaptability and its preparation method and application
  • Endo-xylanase reorganized mutant having improved salt adaptability and its preparation method and application
  • Endo-xylanase reorganized mutant having improved salt adaptability and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Construction of mutant library

[0032] ①The genomes of Arthrobacter sp. and Lechevalieria sp. were extracted according to the instructions of the GENE STAR Bacterial Genome Extraction Kit.

[0033] ②According to the Arthrobacter sp. endoxylanase nucleotide sequence JQ863105 (SEQ ID No.3) recorded in GenBank, primers 5' GTGCAGCCGGAGGAAAAACG 3' and 5' GATGAAGGCAGGATCCGGGGT 3' were designed to target Arthrobacter sp. ) genome as a template for PCR amplification to obtain the endoxylanase gene xynAGN16L; in addition, according to the nucleotide sequence JF745868 (SEQ ID No. 4) Design primers 5'GTCTCGGCCCCGCCGGACGT 3' and 5'GGCTCGCTTCGCCAGCGTGG 3', and perform PCR amplification using the Lechevalieria sp. genome as a template to obtain the endoxylanase gene xynAHJ3.

[0034] ③PCR reaction parameters are: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 1 min and 30 sec, and after 30 cycles,...

Embodiment 2

[0040] Example 2: Screening of Mutants

[0041] 1) Take 2 μL of bacterial liquid from the 96-well cell culture plate in which the mutant library is stored, and inoculate it into 200 μL / well liquid LB culture medium (containing 100 μg mL -1 Amp) in a 96-deep-well plate at 37°C with shaking at 200rpm until OD 600 >1.0 (about 20h), add 2mM IPTG and 100μg mL -1 Amp was induced overnight at 20° C. with 160 rpm in 200 μL liquid LB culture solution.

[0042] 2) Add 40 μL / well of PopCulture after induction TM Cell lysate, at 25°C, shake and lyse the cells for 30 minutes.

[0043] 3) Take 50 μL of McIlvaine buffer (pH=7.0) containing 1.0% (w / v) beech xylan and 50 μL of cell lysate, and react in a 96 deep-well plate in a 70° C. incubator for 2 hours. After the reaction, add 150 μL of DNS reagent to terminate the reaction, incubate in a 140°C incubator for more than 20 minutes and cool to room temperature, and use a microplate reader to read the OD 540nm The value of E.coli BL21-Gol...

Embodiment 3

[0047] Embodiment 3: Enzyme preparation of mutant S35H04 and wild enzyme rXynAGN16L and rXynAHJ3

[0048] The recombinant strains containing mutant S35H04, wild enzymes rXynAGN16L and rXynAHJ3 were inoculated in LB (containing 100 μg mL -1 Amp) medium, shake rapidly at 37°C for 16h.

[0049] Then inoculate the activated bacterial solution into fresh LB (containing 100 μg mL -1 Amp) culture medium, rapid shaking culture for about 2–3h (OD 600 After reaching 0.6-1.0), add IPTG at a final concentration of 0.1 mM for induction, and continue shaking culture at 20° C. for about 20 h. Centrifuge at 12000rpm for 5min to collect the bacteria. After suspending the bacteria with an appropriate amount of pH=7.0 Tris-HCl buffer solution, the bacteria were disrupted ultrasonically in a low-temperature water bath. The crude enzyme solution concentrated in the cells above was centrifuged at 13,000rpm for 10min, the supernatant was aspirated and the target protein was affinity-purified wit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of genetic engineering and protein modification and particularly relates to an endo-xylanase mutant having improved salt adaptability and its preparation method and application. The amino acid sequence of the mutant S35H04 is shown in the formula of SEQ ID NO. 1, the optimum pH is 5.0, the optimum temperature is 65 DEG C, and the half-life period at 50 DEG C is 30min. Compared with the wild-type enzyme, the endo-xylanase mutant S35H04 has better activity in 10.0 mM of beta-Mercaptoethanol, CoCl2 and FeSO4, better activity in 20.0-25.0% (w / v) of NaCl and better activity in 10.0 to 30.0% (w / v) of KCl. The endo-xylanase mutant S35H04 can be used in the technical field of a food industry, seafood processing and high salt environmental biotechnology.

Description

technical field [0001] The invention relates to the technical field of genetic engineering and protein transformation, in particular to an endoxylanase mutant with improved salt adaptability and application thereof. Background technique [0002] The main chain of xylan is a polysaccharide formed by the polymerization of xylose, and the side chain contains residues such as L-arabinose. Xylan is the most abundant polysaccharide in hemicellulose. It is widely found in crop resources such as corncobs, bagasse, wheat bran, and straw, and can account for up to one-third of the dry weight of plant cells. Endo-xylanase can degrade the main chain structure of xylan to produce xylooligosaccharides and / or xylose, which can be applied in the fields of food, brewing, feed, textile and papermaking (Collins et al.FEMS Microbiol Rev, 2005, 29:3–23.). [0003] Salt-tolerant enzymes can be used in high-salt food and seafood processing and other high-salt environment biotechnology fields, su...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/70C12N1/21A23L33/10
CPCC12N9/2482C12Y302/01008
Inventor 周峻沛黄遵锡张蕊何丽梅唐湘华李俊俊吴倩沈骥冬
Owner YUNNAN NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap