Endo-xylanase mutant S07A11 as well as preparation method and application thereof

A technology of S07A11, endo-xylanase, which is applied in the field of genetic engineering and can solve problems such as lack of salt resistance of enzymes

Active Publication Date: 2020-10-09
YUNNAN NORMAL UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most enzymes lack functional studies on salt resistance, especially the effect of high concentration salt on their catalytic activity, and the mechanism of salt tolerance remains to be elucidated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Endo-xylanase mutant S07A11 as well as preparation method and application thereof
  • Endo-xylanase mutant S07A11 as well as preparation method and application thereof
  • Endo-xylanase mutant S07A11 as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Construction of embodiment 1 mutant library

[0032] 1) Genomes of Arthrobacter sp. and Lechevalieria sp. were extracted according to the instructions of the GENE STAR Bacterial Genome Extraction Kit.

[0033] 2) According to the Arthrobacter sp. endoxylanase nucleotide sequence JQ863105 (SEQ ID No.3) recorded in GenBank, primers 5'GTGCAGC CGGAGGAAAAACG 3' and 5'GATGAAGGCAGGATCCGGGGT 3' were designed to detect Arthrobacter sp. (Arthrobacter sp.) genome was used as a template for PCR amplification to obtain the endoxylanase gene xynAGN16L; in addition, according to the nucleotide sequence of Lechevalieria sp. endoxylanase JF745868 ( SEQ ID No.4), design primers 5'GTCTCGGCCCCGCCGGACGT 3' and 5'GGCTC GCTTCGCCAGCGTGG 3', use Lechevalieria sp. genome as template for PCR amplification to obtain endoxylanase gene xynAHJ3.

[0034] The PCR reaction parameters were: denaturation at 94°C for 5 min; then denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at...

Embodiment 2

[0040] Screening of embodiment 2 mutants

[0041] 1) Take 2 μL of bacterial liquid from the 96-well cell culture plate in which the mutant library is stored, and inoculate it into 200 μL / well liquid LB culture medium (containing 100 μg mL -1 Amp) in a 96-deep-well plate at 37°C with shaking at 200rpm until OD 600 >1.0 (about 20h), add 2mM IPTG and 100μg mL -1 Amp was induced overnight at 20° C. with 160 rpm in 200 μL liquid LB culture solution.

[0042] 2) Add 40 μL / well of PopCulture after induction TM Cell lysate, shake and lyse cells at 25°C for 30 minutes.

[0043] 3) Take 50 μL of McIlvaine buffer (pH=7.0) containing 1.0% (w / v) beech xylan and 50 μL of cell lysate, and react in a 96 deep-well plate in a 70° C. incubator for 2 hours. After the reaction, add 150 μL of DNS reagent to terminate the reaction, incubate in a 140°C incubator for more than 20 minutes and cool to room temperature, and use a microplate reader to read the OD 540nm The value of E.coli BL21-Gold (...

Embodiment 3

[0047] Example 3 Enzyme Preparation of Mutant S07A11 and Wild Enzymes rXynAGN16L and rXynAHJ3

[0048] The recombinant strains containing mutant S07A11, wild enzymes rXynAGN16L and rXynAHJ3 were inoculated in LB (containing 100 μg mL -1 Amp) medium, shake rapidly at 37°C for 16h.

[0049] Then inoculate the activated bacterial solution into fresh LB (containing 100 μg mL -1 Amp) culture medium, rapid shaking culture for about 2 ~ 3h (OD 600 After reaching 0.6-1.0), add IPTG with a final concentration of 0.1 mM for induction, and continue shaking culture at 20° C. for about 20 h. Centrifuge at 12000rpm for 5min to collect the bacteria. After suspending the bacteria with an appropriate amount of pH=7.0 Tris-HCl buffer solution, the bacteria were disrupted ultrasonically in a low-temperature water bath. After the crude enzyme solution concentrated in the cells was centrifuged at 13,000 rpm for 10 min, the supernatant was aspirated and the target protein was affinity-purified ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an endo-xylanase mutant S07A11 as well as a preparation method and application thereof, the amino acid sequence of the mutant S07A11 is as shown in SEQ ID NO.1, the optimum pHvalue of the mutant S07A11 is 5.0, and the optimum temperature of the mutant S07A11 is 70 DEG C. Compared with wild enzymes, the activity of the mutant endo-xylanase S07A11 in beta-Mercaptoethanol ZnSO4 and FeSO4 of 10.0 mM, in NaCl and Na2SO4 of 3.0 to 25.0 percent (w / v) and in 3.0 to 30.0 percent (w / v) NaNO3 is improved. The mutant endo-xylanase S07A11 disclosed by the invention can be applied to the biotechnical fields of soy sauce brewing, detergent additives, sewage treatment and the like.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to protein transformation technology, specifically an endo-xylanase mutant S07A11 and its preparation method and application. Background technique [0002] Lignocellulose is the main dry matter produced by plants through photosynthesis and is the most abundant biomass on Earth. Lignocellulose is a polymeric complex composed of lignin (18–30%), cellulose (28–50%) and hemicellulose (20–30%). Xylan is the main component of hemicellulose and is the most abundant heterogeneous polysaccharide in hemicellulose. Endoxylanase is an enzyme that plays an important role in the degradation of xylan, produces xylooligosaccharides, and can be used in the fields of food, feed, papermaking, washing, environmental protection and energy (Collins et al. FEMS Microbiol Rev, 2005, 29:3–23.). Sodium chloride, sulfate, sulfonate, carbonate and other salts widely exist in nature and in various p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/42C12N15/56C12N15/70C12N1/21A23L27/50C02F3/34C11D3/386C12R1/19
CPCA23L27/50C02F3/342C11D3/38636C12N9/2482C12N15/70C12Y302/01008
Inventor 张蕊周峻沛黄遵锡付昭朱泓羲沈骥冬吴倩慕跃林
Owner YUNNAN NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap