Cereal cyst nematode ha-56573 gene and its application
A technology of ha-56573, cereal cyst nematode, applied in application, nematocide, genetic engineering, etc., can solve the problem of decreased host positioning ability and other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Embodiment 1, the screening of RNAi lethal phenotype gene
[0019] The transcriptome of Cereal cyst nematode was sequenced, and the homologous sequence alignment was performed with the RNAi phenotype lethal database in C. elegans collected by Wormbase database (http: / / www.wormbase.org / ). Identification of genes that are homologous (e-value of ≤ 1.0e-40) to C. elegans and have an RNAi lethal phenotype in wheat graminearum cyst nematode. Download plant protein (Embryophyta protein database, NCBI txid3193), vertebrate protein (Craniata protein database, NCBI Itxid89593) and insect protein (Insect protein database, NCBI txid6960) from the NCBI database (http: / / www.ncbi.nlm.nih.gov / ) )database. Local nucleic acid databases were established based on the collected protein sequences. Using native BLAST, the candidate genes with RNAi phenotype lethality in wheat cereal cyst lines were analyzed by tBLASTX or BLASTX (e-value≤1.0e-5), respectively. Obtaining RNAi phenotype-letha...
Embodiment 2
[0024] Example 2. In vitro RNAi interference to verify the function of Ha-56573
[0025] 1. Synthesis of dsRNA, design of specific primers for amplifying target fragments:
[0026] Ha-56573F1: 5'-GGAGCCATTCTTTGCTCAAG-3';
[0027] Ha-56573R1: 5'-TTCTGTACCGCTTCCGATTC-3'
[0028] Ha-56573F2: 5'-ACCTCAACAGGGACAAATCG-3';
[0029] Ha-56573R2: 5'-TCATCTGTTCCTCCAACTCC-3'
[0030] Ha-56573F3: 5'-GAATCGGAAGCGGTACAGAA-3';
[0031] Ha-56573R3: 5'-CGATTTGTCCCTGTTGAGGT-3'
[0032] And the T7 promoter sequence TAATACGACTCACTATAGGG was introduced at the 5' end of the specific primer. The dsRNA template was synthesized and purified for further experiments. Follow Hisscribe TM Follow the instructions of the RNAi Transcription kit, and the specific steps are as follows: RNase-Free water 24 μl, 10×Transcription Buffer 4 μl, 20×RibonucleotideSolution Mix 2 μl, DNA template 6 μl (PCR product obtained in the previous step, 1 μg), 20×HMV Mix 2 μl, T7 RNApolymerase 2μl, total volume 40μl. Af...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



