Unlock instant, AI-driven research and patent intelligence for your innovation.

Cereal cyst nematode ha-56573 gene and its application

A technology of ha-56573, cereal cyst nematode, applied in application, nematocide, genetic engineering, etc., can solve the problem of decreased host positioning ability and other issues

Active Publication Date: 2019-09-06
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Chen et al. (2005) further improved the soaking stimulation system and knocked out and silenced the protein gene Gr-ams-1 secreted by the lateral organ of the potato golden nematode G. rostorchiensis, which resulted in the localization ability of the second instar larvae of G. rostorchiensis to the host Decline (Chen Q, Rehman S, SmartG, Jones JT. Functional analysis of pathogenicity proteins of the potato cystnematode Globodera rostochiensis using RNAi. Molecular Plant-Microbe Interactions. 2005,18:621-625.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cereal cyst nematode ha-56573 gene and its application
  • Cereal cyst nematode ha-56573 gene and its application
  • Cereal cyst nematode ha-56573 gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Embodiment 1, the screening of RNAi lethal phenotype gene

[0019] The transcriptome of Cereal cyst nematode was sequenced, and the homologous sequence alignment was performed with the RNAi phenotype lethal database in C. elegans collected by Wormbase database (http: / / www.wormbase.org / ). Identification of genes that are homologous (e-value of ≤ 1.0e-40) to C. elegans and have an RNAi lethal phenotype in wheat graminearum cyst nematode. Download plant protein (Embryophyta protein database, NCBI txid3193), vertebrate protein (Craniata protein database, NCBI Itxid89593) and insect protein (Insect protein database, NCBI txid6960) from the NCBI database (http: / / www.ncbi.nlm.nih.gov / ) )database. Local nucleic acid databases were established based on the collected protein sequences. Using native BLAST, the candidate genes with RNAi phenotype lethality in wheat cereal cyst lines were analyzed by tBLASTX or BLASTX (e-value≤1.0e-5), respectively. Obtaining RNAi phenotype-letha...

Embodiment 2

[0024] Example 2. In vitro RNAi interference to verify the function of Ha-56573

[0025] 1. Synthesis of dsRNA, design of specific primers for amplifying target fragments:

[0026] Ha-56573F1: 5'-GGAGCCATTCTTTGCTCAAG-3';

[0027] Ha-56573R1: 5'-TTCTGTACCGCTTCCGATTC-3'

[0028] Ha-56573F2: 5'-ACCTCAACAGGGACAAATCG-3';

[0029] Ha-56573R2: 5'-TCATCTGTTCCTCCAACTCC-3'

[0030] Ha-56573F3: 5'-GAATCGGAAGCGGTACAGAA-3';

[0031] Ha-56573R3: 5'-CGATTTGTCCCTGTTGAGGT-3'

[0032] And the T7 promoter sequence TAATACGACTCACTATAGGG was introduced at the 5' end of the specific primer. The dsRNA template was synthesized and purified for further experiments. Follow Hisscribe TM Follow the instructions of the RNAi Transcription kit, and the specific steps are as follows: RNase-Free water 24 μl, 10×Transcription Buffer 4 μl, 20×RibonucleotideSolution Mix 2 μl, DNA template 6 μl (PCR product obtained in the previous step, 1 μg), 20×HMV Mix 2 μl, T7 RNApolymerase 2μl, total volume 40μl. Af...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a heterodera avenae Ha-56573 gene and an application thereof. The Ha-56573 gene of heterodera avenae has the sequence shown in SEQ ID NO: 1. The provided Ha-56573 gene is a lethal phenotype gene. The impact of dsRNA treatment on activity, infection ability and complete life cycle of heterodera avenae is measured through an in-vitro interferential method, and the function of the Ha-56573 gene is verified. It is shown that after a Ha-56573 target gene having a lethal effect is treated by Ha-56573-dsRNA1, Ha-56573-dsRNA2 and Ha-56573-dsRNA3, the female amount is reduced by 38.5%, 65.81% and 53.8%, respectively, when compared with that of a contrast, and the Ha-56573 target gene can used for controlling heterodera avenae.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a Ha-56573 gene derived from cereal cyst nematode and application thereof. Background technique [0002] Grain cyst nematodes (Cereal cyst nematodes, referred to as CCNs) are a serious threat to wheat production and have occurred in 38 countries around the world. Since my country was first discovered in Hubei in 1991, in less than 30 years, It has been found in 16 provinces and cities in my country, including Henan, Hebei, Tibet, and Xinjiang. CCN occurs in 80% of the wheat producing areas in my country, covering the main wheat producing areas in my country, especially in the Huanghuai wheat area, where the damage is the most serious, with an area of ​​more than 60 million mu, and an annual output loss of more than 23%-50%. The production of serious plots has been reduced by 73%-89%, and even the crops have been destroyed, and there is a trend of accelerating spread [Peng D L, Nicol J M...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C12N15/113A01N57/16A01P5/00
Inventor 彭德良乔芬彭焕黄文坤孔令安崔江宽王高峰刘敬罗书介
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI