Primer for fluorescent quantitative detection of strawberry mottle virus and application of primer

A fluorescent quantitative detection, mottled virus technology, applied in the biological field

Pending Publication Date: 2022-06-07
BEIJING UNIV OF AGRI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

SMoV has strain differentiation phenomenon
In 2003, Thompson et al. compared and analyzed the nucleic acid sequences of the genes that translate the large coat protein and the genes that translate RNA polymerase from different isolates of SMoV, and found that there are large differences in the sequences between different isolates, and the largest difference can be reached 72.8%, but the affinities of the isolates obtained from the same geographic location were relatively close

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for fluorescent quantitative detection of strawberry mottle virus and application of primer
  • Primer for fluorescent quantitative detection of strawberry mottle virus and application of primer
  • Primer for fluorescent quantitative detection of strawberry mottle virus and application of primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1, determination of strawberry mottle virus fluorescence quantitative detection method

[0028] First, the determination of primers

[0029] The inventors of the present invention in the study of strawberry mottled virus and sequence determination, screened and synthesized the following SMoV fluorescence quantitative detection primer sequence, SM6364F: 5′CGCCGACAGTTCTCTATG3' (sequence in the sequence list 1), SM6517R: 5'ATACACCACCAGCGCCTCTTT3 '(sequence 2 in the sequence list). The primers are synthesized in Shanghai Shenggong Company.

[0030] Second, the establishment of standard curves

[0031] 1. Amplification of the target fragment

[0032] The RNA extracted from the SMoV-positive strawberry leaf samples collected in 2019.10 in Changping Jinliuhuan, Beijing was reverse-recorded into cDNA, and the SMoV target fragment was amplified using primers SM6364F: CGCCGACAGTTCTCTATG, SM6517: ATACACCACCAGCCTCTT, with a fragment size of 153 bp and a target fragment located ...

Embodiment 2

[0054] Example 2, real-time fluorescence quantification method for the detection of field samples

[0055] 1. Sample source

[0056] 2019.10 40 strawberry samples collected from Beijing Changping Jinliuhuan Agricultural Park, including SMoV strawberry plants Liaoning Donggang Hongyan No. 3, Liaoning Donggang Hongyan No. 9 and negative samples as control, were placed at -80 °C for storage.

[0057] 2. Detection of field samples

[0058] RT-qPCR and RT-PCR were used to detect whether 40 strawberries were infected with SmoV.

[0059] The RT-qPCR method is as follows:

[0060] (1) Extraction of the total RNA of the biological sample to be measured;

[0061] (2) RNA in step (1) as a template, reverse transcription to cDNA, with the fluorescence quantitative detection primers according to claim 1 for fluorescence quantitative detection;

[0062] (3) Via QuantStudio TM 6Flex fluorescence quantitative thermal cycler instrument for detection, and experimental validity judgment; If there is...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer and a method for fluorescent quantitative detection of strawberry mottle virus. The primer group consists of nucleotide shown as a sequence 1 in a sequence table and nucleotide shown as a sequence 2 in the sequence table. The primer composition disclosed by the invention has the characteristics of high sensitivity, high speed, strong specificity, simplicity, convenience, safety and the like. The sensitivity of the SMoV fluorescent quantitative system is higher than that of conventional RT-PCR detection, and the SMoV fluorescent quantitative system can be used for strawberry virus

Description

Technical field [0001] The present invention relates to the field of biotechnology, in particular, the present invention relates to a method of fluorescence quantitative detection of strawberry mottled virus. Background [0002] Strawberry is a perennial herb belonging to the family Rosaceae in the genus Fragaria. Strawberry fruit is deeply loved by the general public because of its high nutritional value and sweet taste. Nowadays, strawberries have become one of the more important cash crops in China. After nearly 30 years of development, the strawberry planting area in the country has increased year by year and has become an important part of China's agriculture. [0003] SMoV is a justice ssRNA virus that belongs to the concomitant cowpeaviridae family (Secoviridae) and is not a virus [7] 。 The virus was first identified on the Apple pear strawberry variety in England in the late 1930s, and was first isolated in the mid-1940s by experiments by aphid-borne viruses. SMoV is main...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/701C12Q1/686C12Q2561/113C12Q2563/107C12Q2545/114C12Q2521/107Y02A50/30
Inventor 尚巧霞任俊达白莹雪周宇闫哲祝宁陆凌晨刘建伟
Owner BEIJING UNIV OF AGRI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap