Primer for fluorescent quantitative detection of strawberry mottle virus and application of primer
What is AI technical title?
AI technical title is built by PatSnap AI team. It summarizes the technical point description of the patent document.
A fluorescent quantitative detection, mottled virus technology, applied in the biological field
Pending Publication Date: 2022-06-07
BEIJING UNIV OF AGRI
View PDF0 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
SMoV has strain differentiation phenomenon
In 2003, Thompson et al. compared and analyzed the nucleic acid sequences of the genes that translate the large coat protein and the genes that translate RNApolymerase from different isolates of SMoV, and found that there are large differences in the sequences between different isolates, and the largest difference can be reached 72.8%, but the affinities of the isolates obtained from the same geographic location were relatively close
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0027] Example 1, determination of strawberry mottle virus fluorescence quantitative detection method
[0028] First, the determination of primers
[0029] The inventors of the present invention in the study of strawberry mottled virus and sequence determination, screened and synthesized the following SMoV fluorescence quantitative detection primer sequence, SM6364F: 5′CGCCGACAGTTCTCTATG3' (sequence in the sequence list 1), SM6517R: 5'ATACACCACCAGCGCCTCTTT3 '(sequence 2 in the sequence list). The primers are synthesized in Shanghai Shenggong Company.
[0030] Second, the establishment of standard curves
[0031] 1. Amplification of the target fragment
[0032] The RNA extracted from the SMoV-positive strawberry leaf samples collected in 2019.10 in Changping Jinliuhuan, Beijing was reverse-recorded into cDNA, and the SMoV target fragment was amplified using primers SM6364F: CGCCGACAGTTCTCTATG, SM6517: ATACACCACCAGCCTCTT, with a fragment size of 153 bp and a target fragment located ...
Embodiment 2
[0054] Example 2, real-time fluorescence quantification method for the detection of field samples
[0055] 1. Sample source
[0056] 2019.10 40 strawberry samples collected from Beijing Changping Jinliuhuan Agricultural Park, including SMoV strawberry plants Liaoning Donggang Hongyan No. 3, Liaoning Donggang Hongyan No. 9 and negative samples as control, were placed at -80 °C for storage.
[0057] 2. Detection of field samples
[0058] RT-qPCR and RT-PCR were used to detect whether 40 strawberries were infected with SmoV.
[0059] The RT-qPCR method is as follows:
[0060] (1) Extraction of the total RNA of the biological sample to be measured;
[0061] (2) RNA in step (1) as a template, reverse transcription to cDNA, with the fluorescence quantitative detection primers according to claim 1 for fluorescence quantitative detection;
[0062] (3) Via QuantStudio TM 6Flex fluorescence quantitative thermal cycler instrument for detection, and experimental validity judgment; If there is...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a primer and a method for fluorescent quantitative detection of strawberry mottlevirus. The primer group consists of nucleotide shown as a sequence 1 in a sequence table and nucleotide shown as a sequence 2 in the sequence table. The primer composition disclosed by the invention has the characteristics of high sensitivity, high speed, strong specificity, simplicity, convenience, safety and the like. The sensitivity of the SMoV fluorescent quantitative system is higher than that of conventional RT-PCR detection, and the SMoV fluorescent quantitative system can be used for strawberry virus
Description
Technical field [0001] The present invention relates to the field of biotechnology, in particular, the present invention relates to a method of fluorescence quantitative detection of strawberry mottled virus. Background [0002] Strawberry is a perennial herb belonging to the family Rosaceae in the genusFragaria. Strawberry fruit is deeply loved by the general public because of its high nutritional value and sweet taste. Nowadays, strawberries have become one of the more important cash crops in China. After nearly 30 years of development, the strawberry planting area in the country has increased year by year and has become an important part of China's agriculture. [0003] SMoV is a justice ssRNA virus that belongs to the concomitant cowpeaviridae family (Secoviridae) and is not a virus [7] 。 The virus was first identified on the Apple pear strawberry variety in England in the late 1930s, and was first isolated in the mid-1940s by experiments by aphid-borne viruses. SMoV is main...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.