Two-cistron expression vector suitable for HEK293 cell, and preparation method, expression system and application thereof

An expression vector and bicistronic technology, which is applied in the field of genetic engineering and can solve the problems of inability to screen stably transformed cell lines and not including screening markers.

CN107058387AActive Publication Date: 2017-08-18河南普诺易生物制品研究院有限公司 +1
3 Cites 3 Cited by

Patent Information

Authority / Receiving Office
CN · China
Current Assignee / Owner
Publication Date
2017-08-18

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention relates to a two-cistron expression vector suitable for an HEK293 cell, and a preparation method, an expression system and application thereof, which belong to the technical field of genetic engineering. The two-cistron expression vector suitable for an HEK293 cell comprises the following elements: a first nuclear matrix combined region sequence-promoter-target gene-internal ribosome entry site sequence-screened marker genes-poly A-second nuclear matrix combined region sequence. According to the vector, by utilizing the optimized MAR sequence, the transgenic expression of the HEK293 cell can be significantly improved, the transgenic silencing is overcome, and the efficient long-term expression of the transgene in a host cell can be realized. Meanwhile, the simultaneous expression of the target gene and the screened marker genes can be realized, the false positive cell clone caused by the existence of different expression cassettes can be reduced, the positive cell clone screening rate is increased, and the problem of imbalanced expression of the target gene and the screened marker gene of the traditional vector can be solved.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] A bicistronic expression vector suitable for HEK293 cells and its preparation method, expression system and application belong to the technical field of genetic engineering. Background technique

[0002] The development of genetic engineering technology in the 1970s transformed the use of animal organs, tissues or human blood to extract protein drugs into the production of genetic engineering. Pharmaceutical proteins, including monoclonal antibodies, peptides, and proteins, have become an important part of the pharmaceutical industry and will become an important area of ​​future pharmaceutical development.

[0003] The expression systems of recombinant drug proteins mainly include E.coli, yeast and non-humanized mammalian cell lines. E.coli is suitable for expressing proteins with small molecular weight and relatively simple structure, and the yeast expression system is suitable for expressing proteins with large molecular weight, complex structure an...

Examples

Embodiment 1

[0048] The construction of a bicistronic expression vector suitable for HEK293 cells, the specific steps are as follows:

[0049] 1. Construction of pIRES-H1 vector

[0050] The purpose of this step is to pIRES-neo carrier (its structure is as follows figure 1 Shown) the selection marker gene was replaced by the NPT resistance weakening gene.

[0051] 1) Artificially synthesized NPT resistance weakening gene

[0052] The NPT resistance weakening gene (as shown in SEQ ID NO.3) was designed and artificially synthesized, which was specifically handed over to General Biogene (Anhui) Co., Ltd. to complete.

[0053] In order to facilitate cloning and ensure sequence integrity, when synthesizing the weakened NPT resistance gene, AAC CCCGGGATAATTCCTGCAGCCAAT sequence was introduced at the 5′ end, where AAC was the protective base, CCCGGG was the XmaI restriction site, and ATAATTCCTGCAGCCAAT was the partial sequence on the vector pIRES-Neo (GenBank: U89673.1, bases 1892-1909); the 3...

Embodiment 2

[0077] The construction of the eukaryotic cell expression system, the specific steps are as follows:

[0078] 1. Construction of a bicistronic expression vector containing an exogenous gene of erythropoietin (EPO)

[0079] 1) Synthetic EPO sequence

[0080] According to the EPO sequence published by NCBI (GenBank: JN849371.1, bases 1 to 582), the EPO sequence was artificially synthesized (EcoRI and BamHI restriction sites were introduced at the 5' end and 3' end respectively), and the details were handed over to General Biotech. Gene (Anhui) Co., Ltd. completed.

[0081] 2) Construction of a bicistronic expression vector containing the EPO sequence

[0082] The artificially synthesized EOP sequence was digested with EcoRI / BamHI double-enzyme primers, and pIRES-neo and pIRES-H2 plasmid DNA were simultaneously digested with EcoRI / BamHI double-enzyme. The digestion results were identified by agarose gel electrophoresis, and the digested EPO sequence fragments and pIRES-neo and...

Embodiment 3

[0089] Construction of bicistronic expression vector pIRES-Neo-EPO suitable for HEK293 cells.

[0090] Refer to the method in Example 2 to construct the pIRES-Neo-EPO expression vector containing the EPO exogenous gene, which differs from pIRES-H2-EPO as follows:

[0091] 1) Different screening markers; pIRES-Neo-EPO screening marker is 1906-2709 on the vector (GenBank: U89673.1, base 1906-2709); pIRES-H2-EPO screening marker sequence is as SEQ ID NO.2 shown;

[0092] 2) pIRES-Neo-EPO does not contain the MAR sequence at both ends, and pIRES-H2-EPO contains the human X-29 MAR sequence before the CMV promoter, and contains the β-globin MAR sequence downstream of poly A.

[0093] Construct the pIRES-Neo-EPO eukaryotic cell expression system, and its construction method is the same as that in Example 2.