Unlock instant, AI-driven research and patent intelligence for your innovation.
Double sgRNA-mediated precise genetic modification method and application
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A sg508-w, cystic fibrosis technology, applied in the field of gene editing, can solve the problem of low efficiency and achieve the effect of improving the efficiency of gene editing
Active Publication Date: 2020-09-29
FOSHAN UNIVERSITY
View PDF5 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
At present, although there are some studies on the repair of human CFTR mutation sites, the efficiency is not high or the use of screening marker genes is required
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0049] Example 1 Double sgRNA for constructing cystic fibrosis model
[0050] HEK293 cell line was purchased from ATCC ( CRL-1573TM), culture medium composition: 10% fetal bovine serum (10438026, Gibco)+89% DMEM (11965, Gibco)+1% double antibody (15140122, Gibco), culture condition is 5% CO 2 , 37°C cell culture incubator.
[0051] Cystic fibrosis (Cystic fibrosis, CF) is a genetic disease, 70% of patients are caused by the deletion of the 508th amino acid nucleotide (CTT) encoded by the CFTR gene. In order to effectively construct a cystic fibrosis model, the present invention finally found that the following two sgRNAs can significantly improve the accuracy of cystic fibrosis model establishment through a large number of research experiments. The two sgRNA sequences are respectively:
[0052] sg1: CCUAUGAUGAAUAUAGAUACAGA (SEQ ID NO: 1);
[0053] sg508-W: CCAAAGAUGAUAUUUUCUUUAAU (SEQ ID NO: 2).
Embodiment 2
[0054] Example 2 Double sgRNA-mediated method for constructing a cystic fibrosis cell model
[0055] (1) Preparation of double sgRNA
[0056] 1.1 Synthetic primers sg1-F, sg508-W-F and sg-R:
[0057] sg1-F: TGTAATACGACTCACTATAGGTCTGTATCTATATTCATCATgttttagagctagaaatagc (SEQ ID NO: 3);
[0058] sg508-W-F: TGTAATACGACTCACTATAGGATTAAAAAAATATCATcttgttttagagctagaaatagc (SEQ ID NO: 4)
[0059] sg-R: AAAAGCACCGACTCGGTGCC (SEQ ID NO: 5).
[0060] 1.2 Preparation of double sgRNA transcription template
[0061] Using the px330 plasmid as a template (purchased from addgene, product number: Plasmid#42230), PCR amplification was performed to obtain the transcription templates of the double sgRNA (sg1 and sg508-W), respectively. The reaction systems are shown in Table 1 and Table 2.
[0062] The PCR amplification system of the transcription template of table 1sg1
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention discloses a double sgRNA-mediated gene accurate modification method and an application thereof. According to the invention, two strips of sgRNA are simultaneously used, a CF cell is taken as a model, directional deletion is carried out on nucleotide of the 508th sites amino acid for coding CFTR gene, the pathogenic genotype which is same with the deletion patients of 508th sites amino acid of the CFTR can be obtained, and the method found that compared with single sgRNA, the double sgRNA has higher efficiency for editing. The invention provides the more effective method for cell model construction and gene editing for the gene disease.
Description
technical field [0001] The invention belongs to the field of gene editing, and in particular relates to a double sgRNA-mediated precise gene modification method and its application, in particular to a double sgRNA-mediated method for constructing a cystic fibrosis cell model and its application. Background technique [0002] Gene editing technology has broad application prospects in the fields of agriculture and medicine, and technical methods are being continuously improved and innovated. The main direction of improvement is to improve the accuracy of gene editing. At present, gene editing mainly relies on the three major technologies of zinc finger nuclease (ZFN), TALEN and CRISPR / Cas9. The most widely used is CRISPR / Cas9, which uses one sgRNA, and the efficiency and accuracy still need to be improved. Cystic fibrosis (CF) is a genetic disease that can affect many parts of the body, with the lungs and digestive system most affected. Cystic fibrosis is most common in Caucas...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More