OPG gene editing system for constructing osteoporosis cloned porcine nuclear donor cell line and application of OPG gene editing system

An osteoporosis and gene editing technology, applied in the field of gene editing, can solve the problems of inapplicability and low probability of homozygous mutation progeny, achieve good applicability, improve nuclear localization ability, and increase the number of nuclear localization signals. Effect

Active Publication Date: 2021-05-14
NANJING KGENE GENETIC ENG CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, the method of embryo transfer after microinjection of gene editing materials into fertilized eggs used in the production of mouse models, because the probability of directly obtaining homozygous mutant offspring is very low (less than 5%), hybrid selection of offspring is required. breeding, which is less suitable for modeling large animals (such as pigs) with long gestation periods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • OPG gene editing system for constructing osteoporosis cloned porcine nuclear donor cell line and application of OPG gene editing system
  • OPG gene editing system for constructing osteoporosis cloned porcine nuclear donor cell line and application of OPG gene editing system
  • OPG gene editing system for constructing osteoporosis cloned porcine nuclear donor cell line and application of OPG gene editing system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1, the preparation of plasmid

[0044] 1.1 Preparation of plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO (plasmid pKG-GE3 for short)

[0045] The sequence of the original plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (abbreviated as plasmid pX330) is shown in SEQ ID NO:1. The schematic diagram of the structure of plasmid pX330 is shown in figure 1 . In SEQ ID NO: 1, the 440-725 nucleotides form the CMV enhancer, the 727-1208 nucleotides form the chickenβ-actin promoter, and the 1304-1324 nucleotides encode the SV40 nuclear localization signal (NLS ), the 1325-5449th nucleotide encodes the Cas9 protein, and the 5450-5497th nucleotide encodes the nucleoplasmin nuclear localization signal (NLS).

[0046] Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, referred to as plasmid pKG-GE3, the nucleotide is shown in SEQ ID NO:2. Compared with the plasmid pX330, the plasmid pKG-GE3 has been mainly modified as follows: ① Remove the residual gRNA backbone sequence (GTTTTAGGCTA...

Embodiment 2

[0059] Example 2 Plasmid Proportion Optimization and Effect Comparison of Plasmid pX330 and Plasmid pKG-GE3

[0060] 2.1 Target gRNA design and construction

[0061] 2.1.1 Using Benchling to design target gRNA for RAG1 gene

[0062] RAG1-g4: AGTTATGGCAGAACTCAGTG (SEQ ID NO. 9)

[0063] Synthesize complementary DNA oligos targeting the above RAG1 gene target as follows:

[0064] RAG1-gRNA4S: caccgAGTTATGGCAGAACTCAGTG (SEQ ID NO.10)

[0065] RAG1-gRNA4A: aaacCACTGAGTTCTGCCATAACTc (SEQ ID NO.11)

[0066] Both RAG1-gRNA4S and RAG1-gRNA4A are single-stranded DNA molecules.

[0067] 2.1.2 Primers designed to amplify and detect fragments containing the RAG1 gRNA target

[0068] RAG1-nF126: CCCCATCCAAAGTTTTTAAAGGA (SEQ ID NO. 12)

[0069] RAG1-nR525: TGTGGCAGATGTCACAGTTTAGG (SEQ ID NO. 13)

[0070] 2.1.3 The method of cloning the gRNA sequence into the pKG-U6gRNA backbone vector

[0071] 1) Digest 1ug pKG-U6gRNA plasmid with restriction endonuclease BbsI;

[0072] 2) run the ...

Embodiment 3

[0119] Example 3 OPG gene screening for efficient sgRNA target 1

[0120] 3.1 Genomic DNA extraction

[0121] 18 pigs (male A, B, C, D, E, F, G, H female 1, 2, 3, 4, 5) were respectively performed using Vazyme's FastPure Cell / Tissue DNA Isolation Mini Kit (VazymeCat.DC102-01). , 6, 7, 8, 9, 10) Genomic DNA from ear tissue was extracted by column, quantified using NanoDrop, and stored at -20°C for future use.

[0122] 3.2 Conservation analysis of predetermined targets of OPG gene knockout and adjacent genome sequences

[0123] 3.2.1 Gene information of porcine OPG

[0124]Encodes osteoprotegerin protein, also known as TNF receptor superfamily member 11b (TNFRSF11B); located on chromosome 4; GeneID is 100049688, Sus scrofa. The amino acid sequence encoded by the porcine OPG gene is shown in SEQ ID NO.15. Existing research results have shown that OPG plays a central role in the regulation of osteoclast differentiation and activity. In the porcine genomic DNA, the OPG gene has...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an OPG gene editing system for constructing an osteoporosis cloned porcine nuclear donor cell line and an application of the OPG gene editing system. The invention discloses a CRISPR / Cas9 system for pig OPG gene editing. The CRISPR / Cas9 system comprises a Cas9 expression vector and a gRNA expression vector, the Cas9 expression vector is a pKG-GE3 vector of which the plasmid complete sequence is as shown in SEQ ID NO. 2; the gRNA expression vector is used for expressing gRNA of which the sequence is shown as SEQ ID NO: 49. When the screened gRNA combined modified Cas9 efficient expression vector is used for gene editing, the editing efficiency is remarkably improved compared with that of the original vector.

Description

technical field [0001] The invention belongs to the technical field of gene editing, in particular to an OPG gene editing system for constructing a cloned pig nucleus donor cell line for osteoporosis. Background technique [0002] Osteoporosis (OP) is caused by an imbalance between bone resorption and bone formation, a systemic bone metabolic disease characterized by low bone mass and microarchitectural destruction of bone tissue, increased bone fragility, and susceptibility to fracture . Modern medicine divides osteoporosis into three categories: primary, secondary, and idiopathic osteoporosis. Primary osteoporosis is a sudden reduction of sex hormones and physiological degenerative changes caused by age, and is divided into type I postmenopausal osteoporosis and type II senile osteoporosis. Secondary osteoporosis, induced by disease or drug factors, such as endocrine and metabolic diseases (diabetes, hyperthyroidism), kidney disease, liver disease, etc., drug-induced suc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/85C12N5/10A01K67/027
CPCC12N15/1138C12N15/8509C07K14/70578A01K67/0276C12N2310/20A01K2207/15A01K2217/075A01K2227/108A01K2267/03
Inventor牛冬汪滔陶裴裴曾为俊王磊程锐赵泽英马翔
OwnerNANJING KGENE GENETIC ENG CO LTD