Recombinant coccidiosis vector with MIC3 gene knocked out and detection method of recombinant coccidiosis vector

A detection method and technology of coccidia, which is applied in the field of genetic engineering, can solve the problems such as the unclear mechanism of MIC3 protein and coccidia infection, and achieve the effects of heritability and stability, length reduction and efficiency improvement

Pending Publication Date: 2022-03-11
SOUTH CHINA AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the mechanism of action between MIC3 protein and coccidia infection is not clear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant coccidiosis vector with MIC3 gene knocked out and detection method of recombinant coccidiosis vector
  • Recombinant coccidiosis vector with MIC3 gene knocked out and detection method of recombinant coccidiosis vector
  • Recombinant coccidiosis vector with MIC3 gene knocked out and detection method of recombinant coccidiosis vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] This embodiment provides a coccidia MIC3 gene editing system, the coccidia MIC3 gene editing system includes sgRNA targeting the coccidia MIC3 gene, Cas9 and a homologous recombination plasmid;

[0075] The sgRNA targeting the coccidian MIC3 gene is the nucleotide sequence shown in SEQ ID NO.1;

[0076] The sgRNA targeting the coccidian MIC3 gene is connected to the Cas9 in the same gene editing plasmid;

[0077] The homologous recombination plasmid includes a 5' homology arm, a SAG13 promoter, an EGFP gene and a 3' homology arm connected in sequence.

[0078] SEQ ID NO. 1: tacgaccccgcctactcctacgg.

[0079] The gene editing plasmid is prepared by the following method:

[0080] (1) PCR amplification of the coding sequence of the sgRNA and Cas9 targeting the coccidian MIC3 gene:

[0081] Using SEQ ID NO.3 and SEQ ID NO.4 as primers, and using the pSAG1::Cas9-U6::sgUPRT plasmid as a template, perform a PCR reaction to obtain a PCR product;

[0082] The reaction system ...

Embodiment 2

[0146] This embodiment provides a recombinant coccidia vector, which is a coccidia vector in which the EGFP gene is inserted into the coccidia MIC3 gene after being edited by the coccidia MIC3 gene editing system described in Example 1.

[0147] The schematic diagram of the construction principle of the recombinant coccidian vector is as follows: image 3 As mentioned, the build method is as follows:

[0148] (1) Prepare Eimeria tenella sporozoites:

[0149] Put the sporulated oocyst liquid in a 50mL centrifuge tube, centrifuge at 4000rpm for 10min, discard the supernatant, add sterilized PBS to wash 3 times, centrifuge at 4000rpm for 10min, discard the supernatant, and keep the precipitate;

[0150] Add 1 times the volume of 30% sodium hypochlorite solution to the precipitate, resuspend and let stand for 10 minutes, centrifuge at 1500 rpm for 10 minutes, collect the supernatant, and check the precipitate under a microscope. If there are more sporulated oocysts, add 30% sodiu...

Embodiment 3

[0166] In this embodiment, the recombinant coccidial vector prepared in Example 2 is detected, and the steps are as follows:

[0167] The recombinant coccidian oocysts were collected for genome extraction, and the genome was used as a DNA template to design primers PCR1-F (located in the 5'UTR region of ΔEtMIC3, SEQ ID NO.17), PCR1-R (located downstream of the SAG13 promoter of ΔEtMIC3, SEQ ID NO.17) IDNO.18), PCR2-F (located upstream of EGFP of ΔEtMIC3, SEQ ID NO.19), PCR2-R (located in the 3'UTR region of ΔEtMIC3, SEQ ID NO.20), PCR3-F (located inside the EtMIC3 gene, SEQ ID NO.21), PCR3-R (located inside the EtMIC3 gene, SEQ ID NO.22) for PCR reactions, the amplification system and procedures are the same as those in the construction of gene editing plasmids.

[0168] SEQ ID NO. 17: ttggcgcggaagtctgaagat;

[0169] SEQ ID NO. 18: cctttgctttctgtgtttttccgc;

[0170] SEQ ID NO.19: atggtgagcaagggcgag;

[0171] SEQ ID NO. 20: acccgcagttcaactctgttca;

[0172] SEQ ID NO. 21: aa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an MIC3 gene knockout recombinant coccidiosis vector and a detection method thereof, and belongs to the technical field of gene engineering. The invention provides sgRNA of a targeted coccidium MIC3 gene. The target spot of the sgRNA of the targeted coccidium MIC3 gene is located at the MIC3 gene; a gene editing system is established by sgRNA, Cas9 and homologous recombinant plasmids, coccidiosis MIC3 genes can be accurately knocked out, fluorescence-labeled protein can be homologous recombined to the MIC3 genes, and a recombinant coccidiosis vector for expressing the fluorescence-labeled protein is constructed. The DNA of the recombinant coccidiosis vector is subjected to PCR (Polymerase Chain Reaction) detection and sequencing to indicate that the fluorescence-labeled gene is successfully recombined with the MIC3 gene, and the recombinant coccidiosis vector has an obvious fluorescence signal under a fluorescence microscope to indicate that the MIC3 gene is successfully knocked out and the fluorescence-labeled protein is expressed.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a recombinant coccidian vector for knocking out the MIC3 gene and a detection method thereof. Background technique [0002] Microneme protein (MIC) is a protein secreted by microneme, which has the functions of recognizing, adhering and infecting host cells. The increase of intracellular free calcium level can cause the secretion of micronematin (Carruthers and Sibley, 1999), and when the sporozoites of Eimeria tenella (Eimeria tenella) are exposed to albumin, they can also be stimulated to synthesize MIC protein (Bumstead and Tomley, 2000), and can also be produced when merozoites come into contact with host cells (Carruthers and Sibley, 1997). [0003] Microneme proteins are released from the microneme apex and coat the sporozoites backwards, these proteins play a crucial role in motility and invasion, likely mediating adhesion between the parasite and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/79C12N15/65C12N15/55C12N15/30C12Q1/686
CPCC12N15/113C12N15/79C12N15/65C12N9/22C07K14/455C12Q1/686C12N2310/20C12Q2565/125
Inventor林瑞庆方园婷周德荣翁亚彪陆肖蔡晓懿孟甜王瑞珍
OwnerSOUTH CHINA AGRI UNIV