Check patentability & draft patents in minutes with Patsnap Eureka AI!

A nasopharyngeal cancer risk detection kit

A detection kit and disease risk technology, applied in the field of biotechnology detection, can solve the problems of lack of sensitivity and specificity, and achieve the effect of early prevention

Inactive Publication Date: 2021-07-23
GUANGDONG MEDICAL UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although these indicators alone or in combination provide useful information for the diagnosis of nasopharyngeal carcinoma, they lack sufficient sensitivity and specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A nasopharyngeal cancer risk detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0017] 1 Case collection and grouping

[0018] In this experiment, blood samples were collected from patients with nasopharyngeal carcinoma and healthy subjects. The blood was collected in anticoagulant tubes and stored at -80°C until DNA was extracted. According to the case-control study, 336 cases of nasopharyngeal carcinoma patients admitted to the Affiliated Hospital of Guangdong Medical University from September 2014 to October 2015 and 397 cases of nasopharyngeal carcinoma patients admitted to Guangdong Nanfang Hospital from September 2010 to December 2011 were selected as the case group , were diagnosed as nasopharyngeal carcinoma by histopathology. The control group of 895 cases was collected from September 2014 to October 2015 at the Affiliated Hospital of Guangdong Medical University, with blood collected from age- and sex-matched healthy individuals with routine physical examination. All subjects lived in Guangdong Province, China. All subjects participating in thi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nasopharyngeal cancer risk detection kit for detecting the T / C mutation of human ATF1rs11169571 site, the kit includes: proteinase K, buffer GB, buffer GD, rinsing solution PW, super Pure water, ATF1 upstream primer, ATF1 downstream primer, Go Taq Green Master Mix 2x, RNase Free H 2 O, Hind III enzyme, buffer10x, TBE buffer, agarose, ethidium bromide, bromophenol blue indicator; the ATF1 upstream primer is 5'‑CGCACGATATCTAGTGACAGAGG‑3', and the ATF1 downstream primer is 5'‑TGCAAACCTGTAGGGTAAATGG ‑3'.

Description

technical field [0001] The invention relates to the field of biotechnology detection, in particular to a nasopharyngeal cancer risk detection kit and a method for testing human ATF1 rs11169571 single nucleotide polymorphism. Background technique [0002] Nasopharyngeal carcinoma (NPC) is a common malignant tumor in southern my country, and Guangdong is a high-incidence area. Nasopharyngeal carcinoma refers to the cancer of nasopharyngeal mucosal epithelium, most of which are poorly differentiated squamous cell carcinomas, with high malignancy and hidden location, especially in the pharyngeal recess and the top of the nasopharynx. The early symptoms are not obvious, so it is difficult to early stage It was found that the rate of misdiagnosis and mistreatment is high, up to 12.2%. Therefore, in the diagnosed nasopharyngeal carcinoma, its 5-year survival rate hovers around 50% to 60% for a long time. Early diagnosis of nasopharyngeal carcinoma for early treatment and improving...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12N15/11
CPCC12Q1/6886C12Q2600/156
Inventor 何志巍黄国良彭述堂曾柳燕许南松
Owner GUANGDONG MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More