Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Genes that regulate the number of nodules in root nodule plants and their application in efficient nitrogen fixation

A root nodule and plant technology, applied in the fields of biotechnology and botany, can solve problems such as polluted soil, acidification, and destruction of ecological balance

Active Publication Date: 2022-08-02
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Excessive application of nitrogen fertilizers has caused serious environmental problems such as surface and groundwater pollution and soil acidification, which has become one of the important reasons for destroying ecological balance and seriously threatens the sustainable development of agriculture in my country.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genes that regulate the number of nodules in root nodule plants and their application in efficient nitrogen fixation
  • Genes that regulate the number of nodules in root nodule plants and their application in efficient nitrogen fixation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0063] In an embodiment of the present invention, an interfering molecule that specifically interferes with the transcription of the Rac1 gene is used to down-regulate the expression of the gene. The methods of small molecule interference include but are not limited to: miRNA-regulated gene silencing, sense RNA-induced co-suppression (Cosuppression), antisense RNA inhibition, virus-mediated gene silencing (VIGS), shRNA, dsRNA, Small interfering RNA, hairpin RNA (hairpinRNA, hpRNA)-mediated gene silencing, etc., can also be used in the present invention. In a preferred example, the interfering molecule targets positions 135-472 of the gene encoding the polypeptide of claim 1 .

[0064] As an embodiment of the present invention, the gene encoding Rac1 is knocked out by knocking out the Rac1 gene. For example, the CRISPR / Cas9 system was used for gene editing to knock out the Rac1 gene. As another embodiment of the present invention, the gene encoding Rac1 is knocked out by adop...

Embodiment 1

[0117] Example 1. Cloning of Rac1 gene

[0118] In order to obtain genes that have a regulatory effect on the nodules of legumes, the inventors screened a large number of genes, and after repeated research and experiments, found that the Rac1 gene has a regulatory effect on the number of nodules of soybean plants.

[0119] The nucleotide sequence of the Rac1a gene is shown in SEQ ID NO:1, and the encoded amino acid is shown in SEQ ID NO:3. The nucleotide sequence of the Rac1b gene is shown in SEQ ID NO:2, and the encoded amino acid is shown in SEQ ID NO:4. Both have a high degree of sequence identity.

[0120] SEQ ID NO: 1

[0121]ATGATGAATGCTTCAAAGTTCATTAAATGTGTTACTGTTGGAGATGGAGCTGTTGGGAAAACCTGCATGCTCATTTGCTACACCAGCAACAAGTTCCCCACTGATTACATACCAACAGTATTTGATAATTTTAGTGCCAATGTTGCTGTGGATGGAAGCATTGTCAATTTGGGGCTATGGGACACAGCAGGCCAGGAAGACTACAGCAGGTTGAGGCCATTGAGTTATAGAGGAGCAGACATTTTTGTCTTAGCATTCTCACTGATTAGCAGAGCTAGCTATGAAAATGTTCTCAAGAAGTGGATGCCGGAATTGCGTAGATTTGCACCTAATGTTCCAATTGTTCTTGT...

Embodiment 2

[0128] Example 2. Phenotypic analysis of root nodules after silencing the Rac1 gene

[0129] Since the nucleotide sequences of Rac1a and Rac1b are highly homologous, when designing RNAi primers, the inventors obtained a target position that simultaneously silences both Rac1a and Rac1b.

[0130] The constructed recombinant plasmid vector was transferred into Agrobacterium rhizogenes A. rhizogenes K599 to transform soybean hairy roots, and the co-cultured soybean plants were transferred into sterilized vermiculite for rooting and growth for 7 days, and the rhizobacteria B. japonicum USDA110 Soybean plants were infected, and the nodule status of soybean hairy roots 21 days after docking was counted, and Microsoft Excel 2010 software was used to select the Student T-test method to test the difference in the number of nodules.

[0131] After rhizobia B. japonicum USDA110 infection, the phenotypes of Rac1-RNAi and empty vector plants were as follows figure 1 As shown, A is the root...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a gene regulating the number of nodules of nodule plants and its application in efficient nitrogen fixation. The inventors cloned a new gene for the first time: Rac1 gene. Functional analysis showed that the gene or its regulatory molecules were closely related to the number of nodules in rooted plants. Therefore, the gene can be applied to plant improvement to obtain plants with altered root nodule traits and nitrogen fixation traits.

Description

technical field [0001] The present invention belongs to the fields of biotechnology and botany; more particularly, the present invention relates to a gene regulating the number of nodules of nodule plants and its application in efficient nitrogen fixation. Background technique [0002] Nitrogen is a macronutrient essential for plant growth and a limiting factor in agricultural production. At present, more than half of the world's food is obtained through the application of chemical fertilizers (especially nitrogen fertilizers), and 40 to 60% of crop yields (even up to 90% in tropical soils) are also attributed to the use of nitrogen fertilizers. Excessive use of nitrogen fertilizers not only increases the Production costs, but also a heavy burden on the environment. About 40% are not directly deaminated by plants using nitrogen fertilizers to form N every year 2 returning to the atmosphere, resulting in a serious waste of energy and resources; secondly, the N produced by t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N5/10A01H5/00A01H6/54C12Q1/6895
CPCC12N15/8261C12Q1/6895C07K14/415C12Q2600/158
Inventor 王二涛高锦鹏张晓伟杨军
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com