Genes that regulate the number of nodules in root nodule plants and their application in efficient nitrogen fixation
A root nodule and plant technology, applied in the fields of biotechnology and botany, can solve problems such as polluted soil, acidification, and destruction of ecological balance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0063] In an embodiment of the present invention, an interfering molecule that specifically interferes with the transcription of the Rac1 gene is used to down-regulate the expression of the gene. The methods of small molecule interference include but are not limited to: miRNA-regulated gene silencing, sense RNA-induced co-suppression (Cosuppression), antisense RNA inhibition, virus-mediated gene silencing (VIGS), shRNA, dsRNA, Small interfering RNA, hairpin RNA (hairpinRNA, hpRNA)-mediated gene silencing, etc., can also be used in the present invention. In a preferred example, the interfering molecule targets positions 135-472 of the gene encoding the polypeptide of claim 1 .
[0064] As an embodiment of the present invention, the gene encoding Rac1 is knocked out by knocking out the Rac1 gene. For example, the CRISPR / Cas9 system was used for gene editing to knock out the Rac1 gene. As another embodiment of the present invention, the gene encoding Rac1 is knocked out by adop...
Embodiment 1
[0117] Example 1. Cloning of Rac1 gene
[0118] In order to obtain genes that have a regulatory effect on the nodules of legumes, the inventors screened a large number of genes, and after repeated research and experiments, found that the Rac1 gene has a regulatory effect on the number of nodules of soybean plants.
[0119] The nucleotide sequence of the Rac1a gene is shown in SEQ ID NO:1, and the encoded amino acid is shown in SEQ ID NO:3. The nucleotide sequence of the Rac1b gene is shown in SEQ ID NO:2, and the encoded amino acid is shown in SEQ ID NO:4. Both have a high degree of sequence identity.
[0120] SEQ ID NO: 1
[0121]ATGATGAATGCTTCAAAGTTCATTAAATGTGTTACTGTTGGAGATGGAGCTGTTGGGAAAACCTGCATGCTCATTTGCTACACCAGCAACAAGTTCCCCACTGATTACATACCAACAGTATTTGATAATTTTAGTGCCAATGTTGCTGTGGATGGAAGCATTGTCAATTTGGGGCTATGGGACACAGCAGGCCAGGAAGACTACAGCAGGTTGAGGCCATTGAGTTATAGAGGAGCAGACATTTTTGTCTTAGCATTCTCACTGATTAGCAGAGCTAGCTATGAAAATGTTCTCAAGAAGTGGATGCCGGAATTGCGTAGATTTGCACCTAATGTTCCAATTGTTCTTGT...
Embodiment 2
[0128] Example 2. Phenotypic analysis of root nodules after silencing the Rac1 gene
[0129] Since the nucleotide sequences of Rac1a and Rac1b are highly homologous, when designing RNAi primers, the inventors obtained a target position that simultaneously silences both Rac1a and Rac1b.
[0130] The constructed recombinant plasmid vector was transferred into Agrobacterium rhizogenes A. rhizogenes K599 to transform soybean hairy roots, and the co-cultured soybean plants were transferred into sterilized vermiculite for rooting and growth for 7 days, and the rhizobacteria B. japonicum USDA110 Soybean plants were infected, and the nodule status of soybean hairy roots 21 days after docking was counted, and Microsoft Excel 2010 software was used to select the Student T-test method to test the difference in the number of nodules.
[0131] After rhizobia B. japonicum USDA110 infection, the phenotypes of Rac1-RNAi and empty vector plants were as follows figure 1 As shown, A is the root...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


