A method for preparing immunogenicity-enhanced porcine transmissible gastroenteritis s gene replication-deficient recombinant adenovirus

A recombinant adenovirus and replication-deficient technology, applied in the field of biological vaccines, can solve the problems of low immunogenicity and inability to achieve immune effects, and achieve the effect of strong ability and prevention of TGE

Active Publication Date: 2019-05-31
BEIJING SENKANG BIOTECHNOLOGY DEV CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These genetically engineered vaccine candidate strains overcome the defects of existing conventional vaccines to a certain extent, but their immunogenicity is low, and they still cannot achieve the expected immune effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for preparing immunogenicity-enhanced porcine transmissible gastroenteritis s gene replication-deficient recombinant adenovirus
  • A method for preparing immunogenicity-enhanced porcine transmissible gastroenteritis s gene replication-deficient recombinant adenovirus
  • A method for preparing immunogenicity-enhanced porcine transmissible gastroenteritis s gene replication-deficient recombinant adenovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1 Transformation of recombinant adenovirus shuttle plasmid pacAd5 CMV K-N pA

[0044] According to the ribosome binding site sequence of encephalomyocarditis virus published in the GenBank database (GenebankSequence ID: gb|EF591488.1), synthesize the IRES sequence, and add restriction sites EcoRI and BamHI at both ends of the sequence to obtain the plasmid pEx-IRES .

[0045] The plasmids pEx-IRES and pacAd5 CMV K-N pA were extracted respectively, and the plasmids were respectively digested with restriction endonucleases EcoRI and BamHI, and the double-digested IRES fragment and pacAd5 CMV K-N pA plasmid fragment were purified by agarose gel electrophoresis, and passed through T4 After ligase ligation, DH10b competent cells were transformed, and the shuttle plasmid pacAd5 CMV K-N pA-IRES containing IRES elements was identified and screened, such as figure 1 shown.

Embodiment 2

[0046] Example 2 Construction of recombinant adenovirus shuttle plasmid pacAd5 CMV K-N pA-sAD-IRES

[0047] 2.1 Design of specific primers P1, P2, P3, P4. According to the S gene sequence of TGEV Purdue 115 strain published in the GenBank database, two pairs of specific primers were designed. Primers P1 and P2 were used to amplify the sequence of the A antigen epitope with a length of 501bp; primers P3 and P4 were used to amplify the D antigen The sequence of the epitope. The primer sequences are as follows:

[0048] P1: GGGTACCATGTTAGTTACCAAAACAGCCGT

[0049] P2: AACTTGGGATCCTATTGTCCAGAAAAA

[0050] P3: TTTTCGGGATCCCAAGTTGAAAACACAG

[0051] P4: GGAATTCAAACTATTATCAGACGGT

[0052] 2.2 Cloning plasmid construction containing TGEV S gene. TGEV RNA was extracted using a viral RNA column extraction kit, and TGEV cDNA was obtained by reverse transcription with OligodT as a primer. TGEV cDNA was used as a template and P1 and P2 were used as primers to amplify the sequence sA co...

Embodiment 3

[0054]Example 3 Construction of recombinant adenovirus shuttle plasmid pacAd5 CMV K-N pA-sAD-IRES-Ag85A

[0055] According to the Mycobacterium tuberculosis Ag85A gene published in the GenBank database, the Ag85A gene sequence (1364bp) was synthesized, and restriction sites SpeI and NotI were added at both ends of the sequence to obtain the plasmid pEx-Ag85A. According to the DNA sequence of the Ag85A gene, primers P5 and P6 were designed for the amplification of the Ag85A gene.

[0056] P5: 5'CTAGACTAGTATGCAGCTTGTTGACAGG3'

[0057] P6: 5'ATAAGAATGCGGCCGCCTAGGCGCCCTGGGGCGCGG3'

[0058] Utilize restriction endonuclease SpeI and NotI to digest plasmid pEx-Ag85A and the plasmid pacAd5 CMV K-N pA-sAD-IRES obtained in Example 2, after agarose gel purification and recovery, the Ag85A fragment is inserted into the digested Carrier pacAd5 CMV K-N pA-sAD-IRES, the ligation product was transformed into DH5α competent cells, positive clones were identified and screened by PCR, and the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of an immunogenicity-enhanced porcine transmissible gastroenteritis (TGE) S gene recombinant adenovirus. According to the preparation method, a traditionalreplication-defective adenovirus shuttle plasmid pacAd5 CMV K-N pA is transformed, so as to express two independent genes instantaneously; then DNA sequences at dominant antigen A and D sites of fiber protein of a porcine transmissible gastroenteritis virus (TGEV) and an mycobacterium tuberculosis Ag85A gene are inserted into the transformed shuttle plasmid pacAd5 CMV K-N pA-IRES to obtain a recombinant plasmid pacAd5 CMV K-N pA sAD-IRES-Ag85A. The recombinant plasmid is linearized with a replication-defective adenoviral skeleton DNA pacAd 59.2-100, and co-transfect AD-293 cells, a replication-defective recombinant adenovirus rAd-sAD-IRES-Ag85A is produced through homologous recombination packaging, and the immunogenicity-enhanced porcine transmissible gastroenteritis S gene recombinant adenovirus is further obtained through the steps such as purification, amplification, subpackage and the like.

Description

technical field [0001] The invention relates to the technical field of biological vaccines, in particular to a method for preparing immunogenicity-enhanced porcine transmissible gastroenteritis S gene replication-deficient recombinant adenovirus. Background technique [0002] Porcine transmissible gastroenteritis is an acute and highly contagious disease caused by porcine transmissible gastroenteritis virus (TGEV). Pigs of different breeds and ages are susceptible to this disease, which can cause vomiting, watery diarrhea, dehydration, etc. in pigs of all ages. The mortality rate of pigs within 7 days is as high as 100%, and the mortality rate of adult pigs increases with age. decreasing gradually. However, the symptoms such as anorexia and diarrhea will appear after the pigs, fattening pigs and sows are infected with the disease, which seriously restricts the development of the pig industry. [0003] At the end of the 1950s, relevant reports on the disease began to appear...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/861C12N15/66C12N7/01A61K39/295A61K39/04A61K39/225A61P31/14A61P31/06
CPCA61K39/04A61K39/12A61K2039/5256A61K2039/552A61K2039/70A61P31/06A61P31/14C12N7/00C12N15/66C12N15/86C12N2710/10021C12N2710/10043C12N2770/20034
Inventor刘文晓牛建蕊杨鹏杨丙田
OwnerBEIJING SENKANG BIOTECHNOLOGY DEV CO LTD