Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A rice exogenous stress-induced expression promoter psubs3 and its application

A promoter, rice technology, applied in the fields of biotechnology and plant genetic engineering, can solve the problems of material and energy waste, affecting the normal growth and development of plants, and achieve the effects of enhancing viability, improving flood tolerance, and increasing expression.

Active Publication Date: 2021-12-31
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

While the gene is highly expressed, it also causes waste of material and energy in the process of plant growth, and even the normal growth and development of the plant is affected due to the accumulation of exogenous genes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A rice exogenous stress-induced expression promoter psubs3 and its application
  • A rice exogenous stress-induced expression promoter psubs3 and its application
  • A rice exogenous stress-induced expression promoter psubs3 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Step 1, promoter Psubs3 cloning and pCAMBIA1381-Psubs3 vector construction

[0035] According to the whole genome sequence of rice variety Nipponbare (Oryza sativa L cv. Nipponbare) provided by NCBI, the amplification primers were designed according to the sequence in the sequence table SEQ ID No.1, and the primers were designed according to the characteristics of the selected vector and target gene. Restriction sites. Primers used for amplification were:

[0036] Forward primer: EcoRI GAATTCTTTTACTCACCGTGTCCTCTGTT

[0037] Reverse primer: HindIII AAGCTTTGTATCTCCTCTCTGGTAGTTAG

[0038] Using the rice variety Nipponbare DNA as a template, using the forward primer and reverse primer to amplify the promoter Psubs3, according to the conventional PCR system, the following amplification procedure was adopted:

[0039] Pre-denaturation at 95°C for 5min; denaturation at 95°C for 30s, annealing at 58°C for 30s, extension at 72°C for 2min and 30s, 35 cycles from pre-denaturati...

Embodiment 2

[0052] 1. Obtaining the POssalt2 promoter containing restriction sites

[0053] (1) Design of primers

[0054] According to the whole genome sequence of rice variety Nipponbare (Oryza sativa L cv. Nipponbare) provided by NCBI. Amplification primers are designed according to the promoter sequence of SEQ ID No.2 in the sequence table, and restriction enzyme cutting sites of the primers are designed according to the characteristics of the selected vector and target gene. In this example, the rice binary expression vector pCAMBIA1381 (from pCAMBIA, a publicly available vector, preserved by the Rice Group of the Supervision, Inspection and Testing Center for Components of Transgenic Biological Products, Ministry of Agriculture, Anhui Academy of Agricultural Sciences) is taken as an example. The target gene is the GUS gene. Specifically designed The primer sequences are as follows, the bases in italics are restriction sites:

[0055] Forward primer: GAATTCAATTCCTACTACTTAAATTCCAEco...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a rice exogenous stress-induced expression promoter Psubs3 and application thereof. The sequence of the inducible expression promoter is the nucleotide sequence shown in SEQ ID No: 1, and the present invention also provides another external cause inducible expression promoter, the sequence of which is shown in SEQ ID No: 2. Specifically, the present invention applies the above-mentioned promoters to plant transgenic engineering. The promoter provided by the present invention can initiate the expression of exogenous genes in plants under submerged or salty environments, and is suitable for any plant, especially capable of driving the induced expression of exogenous genes in rice plants, so it can be used to improve and improve The growth characteristics of rice in flooded environment, so as to cultivate ideal rice varieties.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and plant genetic engineering. Specifically, the present invention relates to a rice exogenous stress-induced expression promoter and its application. Background technique [0002] Rice is a food crop widely distributed in southern my country. Flood disasters generally occur from April to July, with heavy rainfall and long periods of time. The growth of early rice is easily affected by it, resulting in a large area of ​​rice flooding, a decline in yield, and in severe cases, even crop failure in some areas, affecting my country's food security. [0003] As a semi-aquatic plant, rice can tolerate a certain degree of flooding, but different rice varieties have different tolerances to complete flooding. Most rice varieties are very sensitive and will die within a week of flooding, but there are some species that can survive weeks of complete flooding. Therefore, the study of the flood toler...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/11C12N15/82A01H5/00A01H6/46
CPCC12N15/8237C12N15/8271C12N15/8273C07K14/415
Inventor 秦瑞英杨亚春李娟李浩魏鹏程杨剑波
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More