Unlock instant, AI-driven research and patent intelligence for your innovation.

RPA (recombinase polymerase amplification) detection primer and probe assembly for genetically modified maize MON810, kit and detection method

A technology of transgenic corn and a detection kit, which is applied in the field of molecular biology, can solve the problems that there are no detection methods and kits for the detection of transgenic corn MON810, and achieve the effect of simple operation and strong specificity

Inactive Publication Date: 2019-02-15
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no detection method and kit for the detection of transgenic maize MON810 by RPA method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RPA (recombinase polymerase amplification) detection primer and probe assembly for genetically modified maize MON810, kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Design and screening of transgenic maize MON810 RPA detection primers and probes

[0029] The target region detected by MON810 RPA in the present invention is the transformant-specific sequence of MON810, that is, the sequence of the junction region between the exogenous insert and the maize genome. The forward and reverse primers are located on both sides of the junction, and the probe covers connected area.

[0030] (1) Primer design

[0031] 5 primers were respectively designed on both sides of the connection point, and the length of the primers was 30-32bp. The sequences of the screening primers of the present invention are as follows:

[0032] F1:TCAACGTGCCCGGTACTGGTTCCCTCTGGC;

[0033] F2: CGCTGAGCGCCCCCCAGCCCGATCGGCAAGT;

[0034] F3:GTGCCCACCACAGCCACCACTTCTCTCTTGG;

[0035] F4: CAGCCACCACTTCTCCTTGGACATCGATGT;

[0036] F5:CCCCAGCCCCGATCGGCAAGTGTGCCCACCA;

[0037] R1: GCTGCAGGTGGTCTTACATTCTAAGAAGGAT;

[0038] R2: TTCTCATGATGAAAGCACTAGTACTGCCAA;

...

Embodiment 2

[0047] The optimization of embodiment 2RPA reaction system

[0048] (1) Determination of amplification temperature

[0049] Under the condition that other amplification conditions of RPA are the same, carry out RPA amplification in the temperature range of 30-45°C, determine the optimal amplification temperature of RPA according to the strength of the fluorescence signal intensity at different temperatures, and finally determine the optimal amplification The temperature was 39°C.

[0050] (2) Determine the concentration of primers and probes

[0051] Primers and probes were prepared at the same concentration, 10 μmol / L, and other amplification conditions of RPA were the same. Amplification was performed at the optimum amplification temperature of 39°C, and primers and probe combinations with different concentrations were amplified. The strength of the fluorescent signal intensity under the combination determines the optimal primer and probe concentration of RPA, and finally ...

Embodiment 3

[0052] The establishment of embodiment 3 kit and detection method thereof

[0053] The RPA detection kit of transgenic corn MON810 was prepared according to the following formula, and the specification of each kit was 50 reactions:

[0054] (1) Detection primer and probe solution: Synthesize forward primer F, reverse primer R and probe P, and prepare the dry powder of primer and probe with sterilized deionized water or ultrapure water with a concentration of 10 μmol / L respectively. Mother liquor, wherein the primer sequences are:

[0055] Forward primer F: TCAACGTGCCCGGTACTGGTTCCCTCTGGC (SEQ ID NO: 1);

[0056] Reverse primer R: CTATTGTAAAGCCAAACTCAGATGAATCAA

[0057] (SEQ ID NO: 2);

[0058] Probe P: GGCTGCACCGACCTGAACGAGGACTTTCGG[FAM-dT]A[THF]CC[BHQ1-dT]TCTTTCATTTCCG-C3-Spacer (SEQ ID NO: 3).

[0059] (2) BufferA (1.5mL): Contains 50mmol / L Tris-HCl, pH 8.4, 80mmol / L KAc, 2mmol / LDTT, 3mmol / L ATP, 200μmol / L dNTPs, 20mmol / L C 4 h 10 N 3 o 5 P, 100 ng / μL creatine kinase,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an RPA (recombinase polymerase amplification) detection primer and probe assembly for genetically modified maize MON810, a kit and a detection method. A primer group comprisestwo specific primers, nucleotide sequences of the two specific primers are represented as SEQ ID No:1-2, and a probe sequence is represented as SEQ ID No:3. The detection kit comprises detection primer and probe solutions, Buffer A, Buffer B and a positive control. The detection method comprises steps as follows: the specific primers and probes are adopted to perform amplification on a sample DNAtemplate at 37-42 DEG C under the actions of recombinase, single-strand binding protein (SSB), strand replacement DNA polymerase and exonuclease, and whether the sample contains the genetically modified maize MON810 component or not is judged with a probe fluorescent signal collecting method. The detection method does not need special instruments, has the characteristics of being rapid, efficient,simple and convenient to operate, high in sensitivity, high in specificity and the like and is suitable for in-situ detection.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, relates to a detection method for transgenic plants and products thereof, in particular to a combination of primers and probes for rapid detection of transgenic corn MON810 using recombinase polymerase amplification technology (Recombinase Polymerase Amplification, RPA), Kits and assay methods. Background technique [0002] In 2016, the global planting area of ​​genetically modified crops reached 185.1 million hectares, an increase of more than 100 times compared with the initial commercialization in 1996. Currently commercially grown genetically modified crops mainly include soybeans, corn, cotton, and rapeseed. The genetically modified corn MON810 is a kind of insect-resistant genetically modified corn developed by Monsanto, which has been approved by my country to be imported as a raw material for processing. Research on rapid and accurate detection methods for genetically modified...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6844C12Q1/6895C12N15/11
CPCC12Q1/6844C12Q1/6895C12Q2521/507C12Q2531/119C12Q2537/1376C12Q2563/107C12Q2522/101
Inventor 汪小福陈笑芸徐俊锋彭城徐晓丽魏巍
Owner ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES