A kit for detecting pathological myopia and its use method and application

A kit and pathological technology, applied in the field of kits for detecting pathological myopia, can solve the problems of increasing eyesight and not being able to effectively control the development of myopia, and achieve strong specificity, which is conducive to the development of new drugs and has a good market application prospect Effect

Active Publication Date: 2021-11-26
QINGDAO UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Optical corrective glasses help to increase vision but cannot effectively control the development of myopia; surgical control of axial lengthening and vitreous surgery laser treatment can only delay the progress of the disease, and it is accompanied by certain risks and damages. The long-term effect also to be verified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kit for detecting pathological myopia and its use method and application
  • A kit for detecting pathological myopia and its use method and application
  • A kit for detecting pathological myopia and its use method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] KIAA1462 Detection of Gene Mutations

[0033] An autosomal dominant 5-generation pedigree strictly followed the diagnostic criteria: ① myopia ≤ -6.0D; ② characteristic fundus changes including optic disc arc spot, leopard pattern fundus, macular degeneration and posterior staphyloma; ③ The age of onset is before elementary school; ④ myopia progressively deepening; Myopia, that is, patients diagnosed as pathological myopia; ①② is a necessary condition. After the phenotype was determined, the family survey was collected. Genealogy maps were generated using Cyrillic software.

[0034] Collect the peripheral blood of at least three patients and one normal immediate relative in the family, extract genomic DNA, use the Agilent Human All Exon Kit exome capture chip, prepare a cluster for data processing, and then find three patients through bioinformatics analysis The total number of mutations in the database is about 2-5 thousand, and the public database is used to filter...

Embodiment 2

[0037] A kit for detecting pathological myopia of the present invention, the kit includes KIAA1462 A reagent for the gene fragment at the c.3385th gene site of the third exon of the gene; the reagent includes a primer pair, the sequence of the sense primer of the primer pair is: TGGGCGAGATAGCAACTCTT, and the sequence of the antisense primer of the primer pair is: GAGGTTAGCAACGGAATGGA. The reagent also includes buffer, mixed solution, magnesium chloride solution, Taq enzyme with a concentration of 1U / μL, DNA template with a concentration of 30ng / μL and double distilled water, the buffer is PCR Buffer, and the mixed solution is dNTP mixture. Wherein, each component and dosage in the reagent are shown in Table 1.

[0038] Table 1 Composition of reagents

[0039] serial number components Dosage 1 10×PCR Buffer 5μL 2 dNTP mixture 2mL each 5μL 3 2.5mL MgCl 2

Embodiment 3

[0041] A method for using a test kit for detecting pathological myopia of the present invention comprises the following steps:

[0042] 1) Genomic DNA extraction: Use the QIAamp DNA Blood Mini Kit kit from QIAGEN to extract peripheral blood genomic DNA; dissolve the obtained DNA in TE for storage, correct the DNA working concentration to 30ng / μL, and store in a -20°C refrigerator;

[0043] 2) PCR amplification: take the kit, the composition of 25 μL PCR reaction system is shown in Table 1, the sequence of the sense primer is: TGGGCGAGATAGCAACTCTT, the sequence of the antisense primer of the primer pair is: GAGGTTAGCAACGGAATGGA; the conditions for PCR amplification are: 95 ℃, 5min; 95℃, 30s, 65℃, 45s, 72℃, 45s, 35 cycles; 72℃, 10min; 4℃, keep warm to get the PCR product;

[0044] 3) PCR product purification: take 5 μL of the PCR product obtained in step 2), add 1 μL of ExoSAP-IT (US PCR purification reagent) from USB Company, and perform purification reaction. The conditions of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a kit for detecting pathological myopia and its application method and application. The present invention includes a reagent for amplifying the gene fragment at the c.3385th gene site of the third exon of the KIAA1462 gene; the reagent includes a pair of primers, the sequence of the sense primer of the pair of primers is: TGGGCGAGATAGCAACTCTT, the antisense of the pair of primers The sequence of the primer is: GAGGTTAGCAACGGAATGGA. The kit of the present invention has high sensitivity and strong specificity. Only a small amount of DNA samples is enough to determine whether the mutation site is mutated, and only one gene site can be detected to obtain the result of this type of pathological myopia. It is convenient to use, The operation is simple, the purpose of early screening is achieved, and it is beneficial to the development of new drugs, and has a good market application prospect.

Description

technical field [0001] The invention relates to the technical field of medical kits, in particular to a kit for detecting pathological myopia and its use method and application. Background technique [0002] Pathologic myopia (Pathologic Myopia, PM) refers to the diopter ≤ -6.0D, accompanied by elongation of the eye axis, and ametropia characterized by retinal and choroidal degeneration. In addition to vision loss, it is often accompanied by some complications such as cataract, amblyopia, macular degeneration and retinal detachment, which are important causes of blindness. According to data, the incidence of myopia has increased sharply in recent years. At present, 80-90% of students suffer from myopia, of which 10-20% are high myopia. Pathological myopia has an incidence rate of 1% in the general population and has become an important cause of blindness. It is estimated that the number of myopia will reach 2.5 billion by 2020, and the disease has increasingly become a ser...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883C12Q1/6869
CPCC12Q1/6869C12Q1/6883C12Q2600/156C12Q2531/113
Inventor 于常红周宇梁涛张心华纪静常文光朱元镇
Owner QINGDAO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap