Unlock instant, AI-driven research and patent intelligence for your innovation.
A kind of flagellin-fiber2 fusion protein, its preparation method and application
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A fusion protein and protein technology, applied in the biological field, can solve the problems of imperfect effect and poor control of poultry type 4 adenovirus disease
Active Publication Date: 2021-06-11
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF2 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
Vaccines have a certain effect on the prevention and control of poultry adenovirus type 4 disease, but the disease still occurs and spreads, indicating that inactivated vaccines that can only produce humoral immune responses cannot control poultry type 4 adenovirus disease well
Humoral immunity and cellular immunity play an important role in the body's immune system, and the currently used inactivated vaccines cannot stimulate the body to produce a cellular immune response, resulting in imperfect effects on the prevention and control of FAdV-4 infection. Therefore, how to develop a vaccine that can Simultaneous activation of humoral and cellular immune responses is the direction of FAdV-4 vaccine research
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0039] Example 1 Fusion expression of avian type 4 adenovirus fiber2 protein and Salmonella typhimurium flagellin flagellin in Sf9 insect cells
[0040] 1.1. Construction of recombinant vector
[0041] (1) PCR amplification of the flagellin-fiber2 gene: the nucleic acid sequence of the artificially synthesized flagellin-fiber2 gene is shown in SEQ ID NO.2.
[0042] The upstream and downstream primers of flagellin-fiber2 are:
[0043] Upstream primer (P1, SEQ ID NO.3): CC GCGGCCGC TTATGGCACAAGTAATCAACA;
[0044] Downstream primer (P2, SEQ ID NO.4): CG AAGCTT AATTACGGGAGGGAGGCCGCTGGA;
[0045] Among them, P1 contains the NotI restriction site, see the underline, and P2 contains the HindIII restriction site, see the underline. A 20 μl reaction system was established after optimizing the PCR reaction conditions and reagents, as shown in Table 1:
[0046] Table 1: Amounts of Specific Substances for PCR Reaction
[0047] template 2 μl Taq polymerase 0.2 μl...
Embodiment 2
[0072] Example 2 Study on the immune protection of the fusion expression product of avian type 4 adenovirus fiber2 protein and Salmonella typhimurium flagellin protein
[0073] (1) The immune protection effect of challenged SPF chickens after immunization
[0074] 80 SPF chickens (provided by Beijing Meria Weitong Experimental Animal Technology Co., Ltd.) were randomly divided into 4 groups, namely the positive challenge group (group inoculated with FAdV-4), the non-challenge group (group not inoculated with FAdV-4) ), 20 μg flagellin-fiber2 recombinant protein immunization group, PBS inoculation group. FAdV-4 was provided by the research group of Liu Jue, Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agriculture and Forestry Sciences. 21 days after the immunization of SPF chickens, the SPF chickens of the four groups were inoculated intramuscularly with FAdV-4 liver tissue grinding virus solution (provided by the Laboratory of Animal Science and T...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention provides a flagellin-fiber2 fusion protein, its preparation method and application. The fusion protein is a fusion protein of avian type 4 adenovirus fiber2 protein and Salmonella typhimurium flagellin with high immune protection. The preparation method is to fuse and clone the artificially encoded flagellin-fiber2 gene into the pFastBac-HA expression vector, form a recombinant Bacmid through gene transposition, and then transfect into Sf9 insect cells, express the fusion protein by using the baculovirus system, and pass Identification by indirect immunofluorescence IFA and Western blot. The cycle of obtaining recombinant baculovirus by the above system is short, and its flagellin-fiber2 fusion protein was immunized to SPF chickens. The results showed that the flagellin-fiber2 fusion protein expressed by the baculovirus system had higher immune protection.
Description
technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a fusion protein flagellin-fiber2 of avian type 4 adenovirus fiber2 protein and Salmonella typhimurium flagellin protein, its preparation method and application. Background technique [0002] Fowl adenovirus (Fowl Adenovirus, FAdV) is a member of the Adenoviridae adenovirus genus, is a DNA virus, and is one of the common infectious disease pathogens in poultry and wild birds. FAdV can be divided into three groups Ⅰ, Ⅱ and Ⅲ according to group-specific antigens. According to the results of the cross-neutralization test, group I avian adenovirus can be divided into 12 serotypes, and different serotypes have the same group antigen. In recent years, clinical cases of chicken inclusion body hepatitis (Inclusion body hepatitis, IBH) and hydropericardium syndrome (HPS) caused by subgroup I adenovirus infection have increased significantly, among which poultry 4 The number of a...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More 
