Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of flagellin-fiber2 fusion protein, its preparation method and application

A fusion protein and protein technology, applied in the biological field, can solve the problems of imperfect effect and poor control of poultry type 4 adenovirus disease

Active Publication Date: 2021-06-11
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Vaccines have a certain effect on the prevention and control of poultry adenovirus type 4 disease, but the disease still occurs and spreads, indicating that inactivated vaccines that can only produce humoral immune responses cannot control poultry type 4 adenovirus disease well
Humoral immunity and cellular immunity play an important role in the body's immune system, and the currently used inactivated vaccines cannot stimulate the body to produce a cellular immune response, resulting in imperfect effects on the prevention and control of FAdV-4 infection. Therefore, how to develop a vaccine that can Simultaneous activation of humoral and cellular immune responses is the direction of FAdV-4 vaccine research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of flagellin-fiber2 fusion protein, its preparation method and application
  • A kind of flagellin-fiber2 fusion protein, its preparation method and application
  • A kind of flagellin-fiber2 fusion protein, its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Fusion expression of avian type 4 adenovirus fiber2 protein and Salmonella typhimurium flagellin flagellin in Sf9 insect cells

[0040] 1.1. Construction of recombinant vector

[0041] (1) PCR amplification of the flagellin-fiber2 gene: the nucleic acid sequence of the artificially synthesized flagellin-fiber2 gene is shown in SEQ ID NO.2.

[0042] The upstream and downstream primers of flagellin-fiber2 are:

[0043] Upstream primer (P1, SEQ ID NO.3): CC GCGGCCGC TTATGGCACAAGTAATCAACA;

[0044] Downstream primer (P2, SEQ ID NO.4): CG AAGCTT AATTACGGGAGGGAGGCCGCTGGA;

[0045] Among them, P1 contains the NotI restriction site, see the underline, and P2 contains the HindIII restriction site, see the underline. A 20 μl reaction system was established after optimizing the PCR reaction conditions and reagents, as shown in Table 1:

[0046] Table 1: Amounts of Specific Substances for PCR Reaction

[0047] template 2 μl Taq polymerase 0.2 μl...

Embodiment 2

[0072] Example 2 Study on the immune protection of the fusion expression product of avian type 4 adenovirus fiber2 protein and Salmonella typhimurium flagellin protein

[0073] (1) The immune protection effect of challenged SPF chickens after immunization

[0074] 80 SPF chickens (provided by Beijing Meria Weitong Experimental Animal Technology Co., Ltd.) were randomly divided into 4 groups, namely the positive challenge group (group inoculated with FAdV-4), the non-challenge group (group not inoculated with FAdV-4) ), 20 μg flagellin-fiber2 recombinant protein immunization group, PBS inoculation group. FAdV-4 was provided by the research group of Liu Jue, Institute of Animal Husbandry and Veterinary Medicine, Beijing Academy of Agriculture and Forestry Sciences. 21 days after the immunization of SPF chickens, the SPF chickens of the four groups were inoculated intramuscularly with FAdV-4 liver tissue grinding virus solution (provided by the Laboratory of Animal Science and T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a flagellin-fiber2 fusion protein, its preparation method and application. The fusion protein is a fusion protein of avian type 4 adenovirus fiber2 protein and Salmonella typhimurium flagellin with high immune protection. The preparation method is to fuse and clone the artificially encoded flagellin-fiber2 gene into the pFastBac-HA expression vector, form a recombinant Bacmid through gene transposition, and then transfect into Sf9 insect cells, express the fusion protein by using the baculovirus system, and pass Identification by indirect immunofluorescence IFA and Western blot. The cycle of obtaining recombinant baculovirus by the above system is short, and its flagellin-fiber2 fusion protein was immunized to SPF chickens. The results showed that the flagellin-fiber2 fusion protein expressed by the baculovirus system had higher immune protection.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a fusion protein flagellin-fiber2 of avian type 4 adenovirus fiber2 protein and Salmonella typhimurium flagellin protein, its preparation method and application. Background technique [0002] Fowl adenovirus (Fowl Adenovirus, FAdV) is a member of the Adenoviridae adenovirus genus, is a DNA virus, and is one of the common infectious disease pathogens in poultry and wild birds. FAdV can be divided into three groups Ⅰ, Ⅱ and Ⅲ according to group-specific antigens. According to the results of the cross-neutralization test, group I avian adenovirus can be divided into 12 serotypes, and different serotypes have the same group antigen. In recent years, clinical cases of chicken inclusion body hepatitis (Inclusion body hepatitis, IBH) and hydropericardium syndrome (HPS) caused by subgroup I adenovirus infection have increased significantly, among which poultry 4 The number of a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/866C12N15/66A61K39/39A61K39/235A61P31/20
Inventor 侯磊刘爵韦莉王菁全荣朱珊珊
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More