Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RecJ protein guided with DNA guide and having nucleic acid incision enzyme activity and application of RecJ protein to gene editing

A nuclease, enzyme protein technology, applied in the field of genetic engineering

Active Publication Date: 2019-08-06
QINGDAO UNIV +3
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] So far, all reported RecJs can only function as exonucleases, and only act on single-stranded DNA or RNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RecJ protein guided with DNA guide and having nucleic acid incision enzyme activity and application of RecJ protein to gene editing
  • RecJ protein guided with DNA guide and having nucleic acid incision enzyme activity and application of RecJ protein to gene editing
  • RecJ protein guided with DNA guide and having nucleic acid incision enzyme activity and application of RecJ protein to gene editing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 3

[0048] Example 3: Directed shearing of plasmids by BaRecJM guided by 5' phosphorylated fragments

[0049] 1. Design of 5′ phosphorylated fragments with different lengths

[0050] Using the pmg36e plasmid as the substrate, design the relevant phosphorylation guide according to the sequence of the site of action, p36e10-f (AAGCCGATGA), p36e10-r (TCATCGGCTT); P36e20-f (TAGATTATGAAAGCCGATGA), P36e20-r (TCATCGGCTTTCATAATCTA); P36e30 -f: TGTTGTCTGTTAGATTATGAAAGCCGATGA, P36e30-r: TCATCGGCTTTCATAATCTAACAGACAACA; P36e40-f (GCAGCGAAGATGTTGTCTGTTAGATTATGAAAGCCGATGA), P36e40-r (TCATCGGCTTTCATAATCTAACAGACAACATCTTCGCTGC). Analyze the shearing effect of BaRecJM guided by phosphorylated guides of different lengths.

[0051] 2. Site-directed cutting of BaRecJM guided by 5′-terminal phosphorylation guide

[0052] Complementary 5′ phosphorylation guide on Mg 2+ Loaded separately with BaRecJM under the influence of guide loaded protein and substrate (protein: fragment: substrate ratio: 5:10:1)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides RecJ protein guided with DNA guide and having nucleic acid incision enzyme activity and an application of the RecJ protein to gene editing. The RecJ nuclease from bacteria, provided by the invention, can be combined with small DNA after phosphorylation, exerts nucleic acid incision enzyme effects on complementary target DNA specific sites, and perform gene editing. The aminoacid sequence of the BaRecJ nuclease is shown as SEQID NO:1. On the other hand, the invention provides a mutant of the BaRecJ nuclease, so that the excision enzyme activity can be effectively weakened, and the capacity for shearing fixedpoints of target DNA by the DNA guide, can be improved. The amino acid sequence of the mutant BaRecJM of the RecJ nuclease is shown as SEQID NO:3. Current reportsshow that Ago protein sheared by the DNA fragment lead is from thermophilic bacteria, and the effect can be exerted at the temperature of being high 65 DEG C. The BaRecJ and the mutant BaRecJM thereof can be used for shearing DNA dual chains at the mild condition of 37 DEG C, so that genetic engineering can be convenient to operate.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a RecJ protein with endonuclease activity guided by a DNA guide and its application in gene editing. Background technique [0002] RecJ proteins belong to a class of phosphodiesterases widely distributed in bacteria, archaea and eukaryotes. Typical RecJ, such as RecJ of Escherichia coli, has three domains, DHH, DHHA1 and OB, which can degrade single-stranded DNA from 5′-3′. RecJ homologues have been found in almost all eukaryotes, prokaryotes, and archaea, indicating that the RecJ gene has been present since early evolution. In addition to specifically degrading DNA from the 5' end of single-stranded DNA, RecJ protein can also degrade RNA from the 3' end of single-stranded RNA. [0003] So far, all reported RecJs can only function as exonucleases, and only act on single-stranded DNA or RNA. Through research on the RecJ protein from Bacillus alkalophilus...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12P19/34C40B50/06C12N9/22
CPCC12N9/22C12P19/34C40B50/06
Inventor 郑明刚王玲徐孟欣王闻马粒雅吕巧
Owner QINGDAO UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More