A rubber tree u6 gene promoter prohbu6.1 and its cloning and application
A prohbu6.1-sk-5g, prohbu6.1-sgrna-163cas9m technology is applied in the field of Hevea U6 gene promoter proHbU6.1 and Hevea RNA polymerase type III promoter, which can solve the problems of limited application and achieve high efficiency The effect of precise varieties and high-efficiency transcriptional activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] The acquisition of embodiment 1 Hevea brasiliensis U6 gene promoter proHbU6.1
[0052] Using the DNA sequences of Arabidopsis thaliana AtU6-26 gene (Genebank accession number: X52528.1) and cotton GhU6-9 gene (Genebank accession number: XR_001680717.1) as a reference, we searched the rubber tree genome database (hevea.catas. cn), found a rubber tree HbU6 gene (Genebank accession number: XR_002491075.1) by means of homologous alignment, and obtained the upstream reference sequence of this gene.
[0053] Using the genomic DNA of the leaves of Hevea brasiliensis Reyan 7-33-97 (cultivated by the Rubber Research Institute of the Chinese Academy of Tropical Agricultural Sciences) as a template, design the following proHbU6.1-F and proHbU6.1-R specific primers to clone the 694bp DNA of the promoter region Fragment:
[0054] proHbU6.1-F: AGACAAGTGAGTGGATCGAGTC;
[0055] proHbU6.1-R: CAGCTCTGTTTCTTCTTGTTTTG;
[0056] KOD FX enzyme (TOYOBO) was used to carry out PCR amplificat...
Embodiment 2
[0059] The construction of embodiment 2 rubber tree gene editing vector
[0060] (1) proHbU6.1 was constructed on the intermediate vector SK-5G vector
[0061] Digest the SK-5G vector and the downstream gRNA fragment with SalI and XhoI, remove the rice U3 promoter on the vector, recover the 2913bp vector backbone fragment, and design primers:
[0062] proHbU6.1-lF:
[0063] GCGGCCGCAGATCTGCTAGCGTCGAC AGACAAGTGAGTGGATCGAG;
[0064] proHbU6.1-lR:
[0065] GTGTTGTGTTCACCTGCGAGC CAGCTCTGTTTCTTCTTGTTTTG (the sequence homologous to the SK-5G vector is underlined).
[0066] Using the rubber tree genomic DNA as a template, use KOD FX enzyme (TOYOBO) in a 20 μl reaction system for pre-denaturation at 95°C for 2 min, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, 35 cycles, and final extension at 72°C for 5 min. The proHbU6.1 promoter fragment was added, and SK-5G vector homologous sequences were introduced at both ends.
[0067] Design ...
Embodiment 3
[0082] Embodiment 3 Hevea protoplast transformation
[0083] In this example, the PEG-mediated editing vector proHbU6.1-sgRNA-163Cas9M was used to transform Hevea protoplasts, and the 163Cas9M vector without the sgRNA expression cassette was used as a control.
[0084] Transfer the rubber tree Reyan 7-33-97 tissue culture seedlings that have been cultivated for one month to 26-28°C for 5-7 days in the dark, and take 2g of leaves at the discoloration stage and immediately soak them in 0.6M mannitol solution for 10 minutes before preparing protoplast. The preparation and transformation process of protoplasts refer to (Yoo, S.D. et al., 2007, Nature Protocols, 2:1565-1575.). The transformed protoplasts were cultured in the dark at 26-28°C for 48 hours and then used for detection of target site mutations.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


