Unlock instant, AI-driven research and patent intelligence for your innovation.

A rubber tree u6 gene promoter prohbu6.1 and its cloning and application

A prohbu6.1-sk-5g, prohbu6.1-sgrna-163cas9m technology is applied in the field of Hevea U6 gene promoter proHbU6.1 and Hevea RNA polymerase type III promoter, which can solve the problems of limited application and achieve high efficiency The effect of precise varieties and high-efficiency transcriptional activity

Active Publication Date: 2020-08-04
RUBBER RES INST CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It can be seen that the lack of a suitable U6 promoter has become a limiting factor for the current rubber tree CRISPR / Cas9 gene editing system, and also limits the application of CRISPR / Cas9 genome editing technology in rubber tree breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A rubber tree u6 gene promoter prohbu6.1 and its cloning and application
  • A rubber tree u6 gene promoter prohbu6.1 and its cloning and application
  • A rubber tree u6 gene promoter prohbu6.1 and its cloning and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] The acquisition of embodiment 1 Hevea brasiliensis U6 gene promoter proHbU6.1

[0052] Using the DNA sequences of Arabidopsis thaliana AtU6-26 gene (Genebank accession number: X52528.1) and cotton GhU6-9 gene (Genebank accession number: XR_001680717.1) as a reference, we searched the rubber tree genome database (hevea.catas. cn), found a rubber tree HbU6 gene (Genebank accession number: XR_002491075.1) by means of homologous alignment, and obtained the upstream reference sequence of this gene.

[0053] Using the genomic DNA of the leaves of Hevea brasiliensis Reyan 7-33-97 (cultivated by the Rubber Research Institute of the Chinese Academy of Tropical Agricultural Sciences) as a template, design the following proHbU6.1-F and proHbU6.1-R specific primers to clone the 694bp DNA of the promoter region Fragment:

[0054] proHbU6.1-F: AGACAAGTGAGTGGATCGAGTC;

[0055] proHbU6.1-R: CAGCTCTGTTTCTTCTTGTTTTG;

[0056] KOD FX enzyme (TOYOBO) was used to carry out PCR amplificat...

Embodiment 2

[0059] The construction of embodiment 2 rubber tree gene editing vector

[0060] (1) proHbU6.1 was constructed on the intermediate vector SK-5G vector

[0061] Digest the SK-5G vector and the downstream gRNA fragment with SalI and XhoI, remove the rice U3 promoter on the vector, recover the 2913bp vector backbone fragment, and design primers:

[0062] proHbU6.1-lF:

[0063] GCGGCCGCAGATCTGCTAGCGTCGAC AGACAAGTGAGTGGATCGAG;

[0064] proHbU6.1-lR:

[0065] GTGTTGTGTTCACCTGCGAGC CAGCTCTGTTTCTTCTTGTTTTG (the sequence homologous to the SK-5G vector is underlined).

[0066] Using the rubber tree genomic DNA as a template, use KOD FX enzyme (TOYOBO) in a 20 μl reaction system for pre-denaturation at 95°C for 2 min, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, 35 cycles, and final extension at 72°C for 5 min. The proHbU6.1 promoter fragment was added, and SK-5G vector homologous sequences were introduced at both ends.

[0067] Design ...

Embodiment 3

[0082] Embodiment 3 Hevea protoplast transformation

[0083] In this example, the PEG-mediated editing vector proHbU6.1-sgRNA-163Cas9M was used to transform Hevea protoplasts, and the 163Cas9M vector without the sgRNA expression cassette was used as a control.

[0084] Transfer the rubber tree Reyan 7-33-97 tissue culture seedlings that have been cultivated for one month to 26-28°C for 5-7 days in the dark, and take 2g of leaves at the discoloration stage and immediately soak them in 0.6M mannitol solution for 10 minutes before preparing protoplast. The preparation and transformation process of protoplasts refer to (Yoo, S.D. et al., 2007, Nature Protocols, 2:1565-1575.). The transformed protoplasts were cultured in the dark at 26-28°C for 48 hours and then used for detection of target site mutations.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering, particularly relates to a rubber tree RNA polymerase III-type promoter, more specifically relates to a rubber tree U6 gene promoter proHbU6.1, and further discloses a cloning method and applications thereof. The invention clones and obtains the rubber tree RNA polymerase III-type promoter-rubber tree endogenous U6 promoter proHbU6.1in hevea brasiliensis for the first time, the promoter is rubber tree endogenous RNA polymerase III-type promoter, the promoter has high-efficiency transcription activity and can drive downstream sgRNA expression, the activity and the feasibility of the promoter for application in rubber tree CRISPR / Cas9 gene editing system are verified by transient transformation of rubber tree protoplasts, andCRISPR / Cas9 mediated rubber tree genome targeted editing is realized.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, specifically relates to a Hevea RNA polymerase type III promoter, more specifically relates to a Hevea U6 gene promoter proHbU6.1, and further discloses its cloning method and application. Background technique [0002] Natural rubber has always been an important strategic material and reserve resource in my country. At present, the breeding of new varieties of rubber trees in my country is still based on traditional hybrid breeding. Due to the slow growth of rubber trees, conventional breeding has the problems of low efficiency and long cycle, which seriously hinders the progress of rubber tree breeding. With the development of biotechnology, the application of molecular breeding technology in rubber trees has accelerated the cultivation of new varieties of rubber trees. The introduction of exogenous genes through Agrobacterium or gene gun has become an important way for the genetic i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00
CPCC07K14/415C12N15/8213
Inventor 辛士超杨先锋范月婷戴雪梅华玉伟黄华孙王春王克剑
Owner RUBBER RES INST CHINESE ACADEMY OF TROPICAL AGRI SCI