Application of Rowan Small Heat Shock Protein and Methods for Improving Plant Abiotic Stress Tolerance

A heat shock protein and tolerance technology, applied in the fields of botany equipment and methods, biochemical equipment and methods, chemical instruments and methods, etc., to achieve the effect of improving abiotic stress tolerance

Active Publication Date: 2021-06-08
BEIJING UNIV OF AGRI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a chaperone protein in response to biotic and abiotic stress, small heat shock protein plays an important role in plant stress response, but there is no report about small heat shock protein in rowan tree

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Rowan Small Heat Shock Protein and Methods for Improving Plant Abiotic Stress Tolerance
  • Application of Rowan Small Heat Shock Protein and Methods for Improving Plant Abiotic Stress Tolerance
  • Application of Rowan Small Heat Shock Protein and Methods for Improving Plant Abiotic Stress Tolerance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] The plant materials used in the experiment were biennial rowan trees in the Forest Planting Resource Garden of Beijing Agricultural College, which is the National Forest Germplasm Resource Preservation Unit. After collecting leaves from 4 plants in different directions in the resource garden, they were immediately frozen in liquid nitrogen, and then stored in a -80°C refrigerator.

[0061] After analyzing the transcriptome data of Rowan tree, a gene sequence similar to the small heat shock protein in Rowan tree was obtained, and cloning primers were designed based on the obtained sequence. Using SpHSP17.3-CF and SpHSP17.3-CR as primers (the specific sequences are shown in Table 1), the Sorbus cDNA and DNA were used as templates to amplify the small heat shock protein open reading frame (ORF) sequence and genome sequence respectively. 2×EasyTaq PCR SuperMix instructions Add each component and set the amplification program, the amplification system is 20 μL, the annealing...

Embodiment 2

[0068] The rowan tree material used in the test was selected from the national forest germplasm resource preservation unit - the seedlings of the rowan tree in the forest tree planting resource garden of Beijing Agricultural College, and the Colombian col-type Arabidopsis thaliana was used for the test in the laboratory.

[0069] The fluorescent quantitative primers of SpHSP17.3 gene were designed, and the β-actin gene of Sorbus argentina was used as internal reference, and Spβ-actinF, Spβ-actinR, SpHSP17.3-QF, SpHSP17.3-QR were used as primers (Table 2) to study the Stress responses of trees to heat, salt and drought.

[0070] Table 2 Primer Sequence

[0071] name Sequence 5'-3' serial number SpHSP17.3-QF GAGGGTCGGCAAGTTCATGA SEQ ID NO.5 SpHSP17.3-QR GCACCGTGACAGTCAAAACC SEQ ID NO.6 Spβ-actinQF TGGATGGCTGGAAGAGGA SEQ ID NO.7 Spβ-actinQR GAGCGGGAAATTGTGAGG SEQ ID NO.8 Atβ-actin QF CTCCTTTGTTGCTGTTGACTAC SEQ ID NO.9 ...

Embodiment 3

[0082] Utilize the primers in Example 1, use Sorbus cDNA as template, annealing temperature is 55°C, extension time is 30s, carry out PCR amplification, recombine with TOPO vector, transform the recombinant vector into Escherichia coli, screen to obtain positive clones, extract to obtain recombinant vector.

[0083] The recombinant vector containing the target gene was subjected to LR reaction with the p35S plasmid, and the p35S-SpHSP17.3 plasmid was obtained by screening.

[0084]The p35S-SpHSP17.3 plasmid was transformed into Agrobacterium by electric shock, and Arabidopsis was infected by the inflorescence infection method: the inflorescences of Arabidopsis thaliana that had been watered in advance and the fruit pods were cut off were completely immersed in the infection solution, infected for 60 seconds, and protected from light After 24 hours of cultivation, it was transferred to normal culture conditions, and the pods were kept for one week to repeat the infection operat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention relates to the field of biotechnology, in particular, it provides an application of the small heat shock protein of Sorbus arborica and a method for improving the tolerance of plant abiotic stress. The present invention discovers for the first time the small heat shock protein in Rowan tree, the amino acid sequence of which is shown in SEQ ID NO.1, the small heat shock protein responds to high temperature stress, salt stress and drought stress, and studies have confirmed that the small heat shock protein can Improving the stress tolerance of plants is of great significance to the study of abiotic stress, introduction and domestication, improvement of germplasm resources and improvement of plant tolerance of rowan tree. The method for improving the abiotic stress tolerance of plants provided by the present invention is realized by regulating the expression of Sorbus small heat shock protein in plants. means.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of a small heat shock protein of Rowan tree and a method for improving abiotic stress tolerance of plants. Background technique [0002] Sorbus pohuashanensis (Hance) Hedl. is a small deciduous tree of the Rosaceae Sorbus genus, with odd-numbered pinnate compound leaves and compound corymbs. It is widely distributed in northern China and some cold regions in Europe, and its original habitat is about 900 meters above sea level. -2500 meters. Sorbus has unique ornamental value throughout the year, and is an excellent tree species for viewing leaves, flowers, and fruits. It has been planted as a street tree in Northeast my country and has shown good adaptability. Rowan tree is also a traditional medicinal plant in my country, which can be used to treat chronic bronchitis, tuberculosis and edema. The main components of the compounds contained in its extract include trit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/20A01H6/74
CPCC07K14/415C12N15/8271C12N15/8273
Inventor 郑健张泽裴鑫
Owner BEIJING UNIV OF AGRI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products