Recombinant propolypeptide ligase and its preparation, activation method and application
A technology of recombinant polypeptide and ligase, which is applied in the direction of ligase, biochemical equipment and methods, recombinant DNA technology, etc., can solve the problems of low expression level of yeast expression system, high cost of separation and purification, and insufficient activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] Example 1 Construction of a recombinant vector containing a nucleotide sequence encoding a recombinant polypeptide ligase
[0070] Constructing a recombinant vector containing a nucleotide sequence encoding a recombinant polypeptide ligase, comprising the following steps:
[0071] (1) According to the amino acid sequence of the pro-polypeptide ligase, after codon optimization of the Escherichia coli expression system, a DNA molecule capable of high-efficiency expression in Escherichia coli is obtained, and the method of splicing PCR is used to artificially synthesize the encoded The DNA molecule of the recombinant polypeptide ligase pro-enzyme is specifically shown in SEQ ID NO:3.
[0072] (2) Construction of pMAL-c5x-His vector
[0073] The gene fragment "GTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCCACTGAGATCCGGCTGCTAACGGATCC" was inserted into the pMAL-c5x vector (provided by Guangzhou Yingzan Biotechnology Co., Ltd.) through the two restriction sites of Nde I: CATATG...
Embodiment 2
[0077] Example 2 Expression and Identification of Recombinant Polypeptide Ligase Pro in Recombinant Escherichia coli
[0078] The recombinant vector obtained in Example 1 was transformed into the host cell Escherichia coli ROSETTA (DE3) (purchased from Shanghai Weidi Biotechnology Co., Ltd.), the positive transformant of E. coli was selected, and inoculated in a medium containing a small amount of kanamycin 30 μg / mL and Ampicillin 50 μg / mL LB culture medium, shaking culture overnight at 25°C in a shaker as seed solution, take the seed solution and inoculate it into the culture medium containing kanamycin 30 μg / mL and ampicillin 50 μg at a ratio of 1:150 by volume. / mL of LB culture medium, cultured at 25°C and 150r / min until the bacterial liquid OD 600 When it reached 0.5, IPTG was added to each bottle of bacterial solution to a final concentration of 0.6mmol / L, and the expression was induced at 15°C for 28 hours, and the bacterial precipitate was collected by centrifugation. ...
Embodiment 3
[0080] Example 3 Recombinant Polypeptide Ligase Pro-purification
[0081] The recombinant vector obtained in Example 1 was transformed into the host cell Escherichia coli ROSETTA (DE3), the E. coli positive transformant was selected, and inoculated in the LB culture fluid containing a small amount of kanamycin 40 μg / mL and ampicillin 75 μg / mL, Shake and culture overnight at 40°C in a shaker as seed liquid, take the seed liquid and inoculate it into LB culture medium containing kanamycin 40 μg / mL and ampicillin 75 μg / mL at a ratio of 1:50 by volume, and inoculate at 40°C , Cultivate to the OD of the bacterial solution under the condition of 250r / min600 When it reached 0.9, IPTG was added to each bottle of bacterial solution to a final concentration of 0.3mmol / L. After inducing expression at 28°C for 15 hours, the bacterial pellet was collected by centrifugation and stored at -20°C for later use.
[0082] Take 1L of fermented thalline obtained by fermentation, and add 10mL of bu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More