Specific DNA fragment SSM1 for sex determination of sturgeons and application
A specific, sturgeon technology, applied in the direction of DNA/RNA fragments, recombinant DNA technology, microorganism determination/inspection, etc., can solve the problem of increasing the difficulty of sex-specific related genes or markers in sturgeon, and failing to detect sturgeon sex-specific Sexual DNA molecular markers and other issues to achieve the effect of less damage to the fish body
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Obtaining the specific DNA fragment SSM1 for sex determination of sturgeon:
[0036] Using paraffin sections of gonad tissue to identify 20 male and female Sturgeon's sturgeons, extract their whole genome DNA, construct a sequencing library, and perform sequencing on the Illumina sequencing platform to obtain the whole genome sequencing data of male and female Sturgeon's sturgeons, which were obtained by comparative genomics analysis The female sex-specific DNA fragment was designed, and the corresponding primers were designed to verify its validity in the population. Finally, the female-specific DNA fragment SSM1 (SEQ ID NO.1) was obtained, and no homologous sequence was found through the comparison of the GenBank database.
Embodiment 2
[0038] The method of using the specific DNA fragment SSM1 for determining the sex of sturgeon:
[0039] 1) Primers designed for the sequence shown in SEQ ID NO.1 are:
[0040]F: TCGGTATCTTAAACTGAACCAA and R: AGATGGAGAATTCATTGCCTA.
[0041] 2) PCR amplification:
[0042] The reaction system is about 50ng of template DNA; 1.5U of Taq polymerase; 2.5μl of 10×amplification buffer; the concentration of four dNTPs is 200μM; the final concentration of upstream and downstream primers is 0.2μM; add ddH2O to 25μl.
[0043] The PCR reaction conditions corresponding to the SSM1 primers were pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 25 s, and 35 cycles; final extension at 72°C for 7 min; storage at 4°C. The PCR reaction conditions corresponding to the Sturgeon-SSM2 primers were pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 25 s, and 35 cycles; ...
Embodiment 3
[0046] Application of specific DNA fragment SSM1 in sturgeon sex identification:
[0047] 1) The fin ray tissue samples of 12 male and female individuals are known to be stored in absolute ethanol, and the genomic DNA is extracted by high-salt method, diluted to 50ng / μL and stored at -20°C for later use; the mentioned sturgeon is: Chinese Acipenser, Acipenser dabryi, Acipenser schrenckii, Acipenser sterlet, Acipenser siberian (Acipenser ♀×Acipenser ♂♂), Acipenser hulus, Acipenser siberian, Acipenser russiensis, Acipenser acipenser.
[0048] 2) Utilize the method for embodiment 2 to carry out PCR amplification to above-mentioned sturgeon DNA sample;
[0049] 3) The amplification results are as follows:
[0050] figure 1 Shows the amplification results of Sturgeon's sturgeon: lanes 1-12 in the figure show that no band can be amplified in male individuals, 13-24 shows that a specific band of 415bp can be amplified in female individuals, C indicates negative control, M indicates...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


