Method for producing ice nucleation protein by fermentation of recombinant Escherichia coli

A technology for recombining Escherichia coli and ice nucleation protein, which is applied in the fields of genetic engineering and microbial fermentation, can solve the problems of low activity, difficulty in stable production, and high expression of ice nucleation active protein, and achieves high activity, short lag period, and moderate expression. Effect

Active Publication Date: 2020-09-22
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, when using the conventional high-density fermented protein method to produce ice-nucleated active protein, the expression level of ice-nucleated active protein is too high, the activity is low, and it is difficult to produce stably.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing ice nucleation protein by fermentation of recombinant Escherichia coli
  • Method for producing ice nucleation protein by fermentation of recombinant Escherichia coli
  • Method for producing ice nucleation protein by fermentation of recombinant Escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Embodiment 1 Utilizes the method for recombinant escherichia coli fermentation to produce ice nuclei protein

[0061] 1. Construction of recombinant Escherichia coli TDTC-inp001 producing ice nucleation protein

[0062] 1.1 Amplification of ice nucleoprotein gene inp

[0063] Using the genomic DNA of Pseudomonas syringae (Psudomonas syringae) TDTC-IN 13 as a template, PCR amplification was performed with the following primers:

[0064] inp-F: ctaacaggaggaattaaccatgaatctcgacaaggcgttg

[0065] inp-R: gagctcggatccccatcgatctactcgacctctatccagtc

[0066] The high-efficiency fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase from Vazyme Biotech Co., Ltd. was used for PCR amplification. The PCR amplification program was: 95°C for 3min; 30 cycles of 95°C for 15s, 58°C for 15s, and 72°C for 2min; 72°C for 5min. The obtained PCR product was subjected to electrophoresis and then gel-cut, and the gel recovery kit of Omega Company was used for gel recovery (operated accordi...

Embodiment 2

[0111] Embodiment 2 Utilizes the method for recombinant escherichia coli to ferment and produce ice nuclei protein

[0112] 1. The recombinant Escherichia coli TDTC-inp004 producing ice nucleation protein, its construction method is as follows:

[0113] 1.1 Amplification of ice nucleoprotein gene inp

[0114] Using the genomic DNA of Pseudomonas syringae (Psudomonas syringae) TDTC-IN 13 as a template, PCR amplification was performed with the following primers:

[0115] inp-F: ctttaagaaggagatataccatgaatctcgacaaggcgttg

[0116] inp-R: gcaagcttgtcgacctgcagctactcgacctctatccagtc

[0117] The high-efficiency fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase from Vazyme Biotech Co., Ltd. was used for PCR amplification. The PCR amplification program was: 95°C for 3min; 30 cycles of 95°C for 15s, 58°C for 15s, and 72°C for 2min; 72°C for 5min. The obtained PCR product was subjected to electrophoresis and then gel-cut, and the gel recovery kit of Omega Company was used for ge...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for producing ice nucleation protein by fermentation of recombinant Escherichia coli. The recombinant Escherichia coli is constructed by introducing an ice nucleation protein gene or an ice nucleation protein gene expression cassette into Escherichia coli through plasmids, or integrating the protein gene or the expression cassette into Escherichia coli chromosomes through a genetic engineering means, and the recombinant Escherichia coli does not contain antibiotic resistance genes. The invention overcomes the defect that most of existing ice nucleation active protein-producing bacteria are plant conditional pathogenic bacteria and have potential harm to ecology. The ice nucleation active protein product produced by adopting the fermentation strategy and themethod has the advantages of high activity, simple production method operation, low cost, good repeatability and the like, is harmless to the environment and high in production strength, and is suitable for stable large-scale industrial production.

Description

technical field [0001] The invention relates to the technical field of genetic engineering and microbial fermentation, in particular to a method for producing ice nuclei protein by recombinant Escherichia coli fermentation. Background technique [0002] Ice-nucleation-active bacteria are a type of bacteria that can catalyze and induce water in plants to produce ice nuclei under low temperature conditions, thereby causing frost. Ice-nucleation-active bacteria are widely epiphytic on plant surfaces (especially leaves). Under normal circumstances, due to the presence of free water in the cells, plants do not freeze even at low temperatures of -7 to -8°C, resulting in supercooling; when ice-nucleating active bacteria exist, this microorganism acts as the strongest heterogeneous ice Nuclear factor, which induces the formation of ice crystals, makes the plant tissue lose its supercooling effect, and then causes frostbite damage to the host plant. Ice-nucleation-active bacteria a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/31C12N15/70C12N15/90C12P21/02C12R1/19
CPCC07K14/21C07K14/245C12N15/70C12N15/902C12N1/20C12N2310/20
Inventor苏毅姜旭晏礼明
OwnerINST OF MICROBIOLOGY - CHINESE ACAD OF SCI