A KASP molecular marker linked to wheat flag leaf long qtl QFll-2B and its application

A molecular marker, kasp-fll-sau1 technology, applied in the fields of molecular biology and crop genetics and breeding, can solve the problem of insufficient molecular markers, achieve accurate and efficient detection, improve selection and identification efficiency, and high success rate

Active Publication Date: 2021-06-01
SICHUAN AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are not many closely linked molecular markers that are related to the flag leaf length trait of wheat and can be used in practical molecular breeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A KASP molecular marker linked to wheat flag leaf long qtl QFll-2B and its application
  • A KASP molecular marker linked to wheat flag leaf long qtl QFll-2B and its application
  • A KASP molecular marker linked to wheat flag leaf long qtl QFll-2B and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Obtainment of Wheat Flag Leaf Length QTLQFLL-2B and Its Molecular Marker KASP-Fll-sau1

[0044] (1) Using the wheat line '20828' as the female parent and the wheat variety 'SY95-71' as the male parent to cross, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 7 Generations, recombinant inbred lines containing 128 lines were obtained to form a genetic mapping population.

[0045] (2) Identification of the flag leaf length phenotype of the recombinant inbred line population: analyze and identify the flag leaf length of the recombinant inbred line at the wheat maturity stage, remove the individual plants at both ends of each row, collect five individual plants with the same growth, and calculate The flag leaf length was obtained, and the average value was obtained, representing the flag leaf length of the strain.

[0046] (3) 55K SNP chip analysis

[0047] a) DNA extraction: The DNA of the parent '20828', 'SY95-71...

Embodiment 2

[0064] Example 2 Application of Molecular Marker KASP-Fll-sau1 in Selection and Control of Flag Leaf Length QTLQFLL-2B

[0065] (1) The common wheat line 'S849-8' with shorter flag leaves was used as the female parent, and the common wheat line 'SY95-71' with longer flag leaves was used as the male parent to construct a recombinant inbred line, and the offspring lines were randomly selected 70 strains.

[0066] (2) Carry out KASP-Fll-sau1 marker detection on the obtained 70 strains, the specific method is: extract the DNA of 70 strains; use it as a template, and use the specific primer pair of molecular marker KASP-Fll-sau1 Perform PCR amplification and perform fluorescence readings for primers, which are:

[0067] Primers on the FAM tag: (the underlined part is the FAM tag sequence)

[0068] 5'- GAAGGTGACCAAGTTCATGCT TATCCTATGGAGTTGGAAAG-3' (SEQ ID No. 1)

[0069] Primers on the HEX tag: (the wavy part is the HEX tag sequence)

[0070]

[0071] Universal downstream p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a KASP molecular marker linked with wheat flag leaf long QTL QFll‑2B and an application thereof. The molecular marker is located on the long arm of chromosome 2B of the RefSeqv1.0 genome. Detection and analysis show that the molecular marker can accurately track the wheat flag leaf length QTL QFll-2B, predict the flag leaf length characteristics of wheat, and facilitate molecular breeding. The invention also discloses a method for identifying the molecular marker of the wheat flag leaf length QTL QFll-2B. The method provided by the invention can enhance the accuracy of the prediction of the flag leaf length, and can more quickly screen out those with longer flag leaves. Wheat varieties or strains are used for breeding, which greatly speeds up the process of wheat breeding.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology and crop genetic breeding, and specifically relates to a KASP molecular marker linked with wheat flag leaf length QTL QFll-2B and an application thereof. Background technique [0002] Common wheat (Triticum aestivum L.) is one of the most important crops in the world, and its sown area accounts for 20%-30% of the country's arable land. It is the staple food of 35% of the population. According to reports, wheat production should increase by 70% to meet future food demand. [0003] With the increase of population and the decrease of available arable land, increasing wheat yield is an important way to solve the contradiction of food demand. Photosynthesis is the basis of crop dry matter accumulation and yield formation. Leaf is the main organ for photosynthesis in wheat. Therefore, the size of flag leaf has a great influence on the final yield of wheat. Flag leaf length is an important ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6895C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q1/6895C12Q2600/13C12Q2600/156C12Q2531/113C12Q2563/107C12Q2535/125
Inventor马建魏育明刘航涂洋郑有良兰秀锦刘亚西江千涛陈国跃
OwnerSICHUAN AGRI UNIV