Unlock instant, AI-driven research and patent intelligence for your innovation.

Polypeptide with obesity inhibiting effect and application thereof

An obesity and functional technology, applied in the field of biomedicine, can solve problems such as limiting wide application, increasing blood pressure, and affecting melanocortin 1 receptors

Active Publication Date: 2021-01-19
XUZHOU MEDICAL UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Predecessors developed weight-loss drugs based on this genetic discovery. Although the first generation of MC4R activators can lose weight, they lead to increased blood pressure, which limits its application
The second-generation MC4R agonists are off-target and affect the melanocortin 1 receptor, which also limits their wide application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptide with obesity inhibiting effect and application thereof
  • Polypeptide with obesity inhibiting effect and application thereof
  • Polypeptide with obesity inhibiting effect and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Obtaining of Polypeptide TAT-MC4R1

[0027] (1) Mammalian cell two-hybrid

[0028] The MC4R1 polypeptide fragment and the recombinant of pBIND (upstream primer 5'CTCAGTCTAGACGGAGTCAAGAACTGAGGAAAACCTTCAAAAGAGATCGTCTGTT 3'(SEQ ID NO.3) and downstream primer 5'CATCGGGTACCATATCTGCTAGACAAGTCACAAAGGCCTCCCAGGGGATAGCAACAGACGATCTCTTTGAAGG 3'(SEQ ID NO.4)in) were combined with β-pArr (upstream primer 5'CTCAGTCTAGAATGGGAGAAAAACCCGGGAC 3'(SEQ ID NO.5) and downstream primer 5'CATCGGGTACCCCTAGCAAAACTGGTCATCACAGTCA 3'(SEQ ID NO.6)) and reporter gene vector pG5luc, co-transfect HEK293 cells, add 1μM NDP-αMSH to treat the cells , after continuing to culture for 48h, the activity of luciferase was detected by using the GloMax-Multi detection system (Promega) with the Dual Luciferase Reporter Gene Detection Kit (Beyotime RG009).

[0029] Depend on figure 1 The results show that MC4R1 polypeptide fragments can interact with β-arrestin 2, and this interaction depends on the pres...

Embodiment 2

[0035] Example 2 Application Research of Polypeptide TAT-MC4R1

[0036] The mice were injected intraperitoneally with 10 mg / kg of TAT-MC4R1 polypeptide every day, and the control group was given the same amount of control polypeptide for 15 consecutive days. The eating conditions of the mice and the changes in the body weight of the mice were detected.

[0037] Depend on figure 2 , image 3 It can be seen that TAT-MC4R1 can significantly reduce the food intake of mice and promote the weight loss of mice. And compared with the control group, no obvious abnormality was found in the health of the mice after the polypeptide was administered.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a polypeptide with an obesity inhibiting effect and application thereof. The polypeptide is named as TAT-MC4R1, and is a polypeptide with an amino acid sequence shown as SEQ IDNO: 1. The polypeptide TAT-MC4R1 provided by the invention is derived from carboxyl terminal amino acid sequence of an MC4R1 receptor, when an agonist acts on the MC4R1 receptor, the TAT-MC4R1 can compete with the carboxyl terminal sequence of the MC4R1 receptor by the G protein coupled receptor kinase, and the phosphorylated TAT-MC4R1 can bind to beta-arrestin 2 and replace MC4R1 receptor to interact with beta-arrestin 2. Therefore, resistance is devloped to obesity and complications such as diabetes induced by obesity. The polypeptide TAT-MC4R1 has application potential in the processes oflosing weight and preventing obesity complications such as diabetes.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a polypeptide with the effect of inhibiting obesity and its application. Background technique [0002] With the improvement of people's living standards and unhealthy lifestyles, obesity has become a concern. Diseases such as diabetes, hypertension, and atherosclerosis caused by obesity seriously threaten human health. At present, a variety of molecular mechanisms have been found to participate in the regulation of body weight, and based on this, a variety of weight loss treatment options have been discovered. However, these drugs either lack target specificity, or can affect a variety of signaling pathways downstream of the target protein, resulting in a variety of side effects. rather than long-term use. Therefore, safe and efficient weight loss methods are urgently needed. [0003] G protein-coupled receptors (GPCRs) are the targets of about 30% of drugs on ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62A61K38/17A61K47/64A61P3/04A61P3/10A61P9/12A61P9/10
CPCA61K38/00A61P3/04A61P3/10A61P9/10A61P9/12C07K14/723C07K2319/10
Inventor 王中山张梦
Owner XUZHOU MEDICAL UNIV