A kind of polypeptide with anti-obesity effect and application thereof
A kind of function, obesity technology, applied in the field of biomedicine, can solve the problems of affecting the melanocortin 1 receptor, increasing blood pressure, and restricting wide application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Obtaining of Polypeptide TAT-MC4R1
[0027] (1) Mammalian cell two-hybrid
[0028] The MC4R1 polypeptide fragment and the recombinant of pBIND (upstream primer 5'CTCAGTCTAGACGGAGTCAAGAACTGAGGAAAACCTTCAAAAGAGATCGTCTGTT 3'(SEQ ID NO.3) and downstream primer 5'CATCGGGTACCATATCTGCTAGACAAGTCACAAAGGCCTCCCAGGGGATAGCAACAGACGATCTCTTTGAAGG 3'(SEQ ID NO.4)in) were combined with β-pArr (upstream primer 5'CTCAGTCTAGAATGGGAGAAAAACCCGGGAC 3'(SEQ ID NO.5) and downstream primer 5'CATCGGGTACCCCTAGCAAAACTGGTCATCACAGTCA 3'(SEQ ID NO.6)) and reporter gene vector pG5luc, co-transfect HEK293 cells, add 1μM NDP-αMSH to treat the cells , after continuing to culture for 48h, the activity of luciferase was detected by using the GloMax-Multi detection system (Promega) with the Dual Luciferase Reporter Gene Detection Kit (Beyotime RG009).
[0029] Depend on figure 1 The results show that MC4R1 polypeptide fragments can interact with β-arrestin 2, and this interaction depends on the pres...
Embodiment 2
[0035] Example 2 Application Research of Polypeptide TAT-MC4R1
[0036] The mice were injected intraperitoneally with 10 mg / kg of TAT-MC4R1 polypeptide every day, and the control group was given the same amount of control polypeptide for 15 consecutive days. The eating conditions of the mice and the changes in the body weight of the mice were detected.
[0037] Depend on figure 2 , image 3 It can be seen that TAT-MC4R1 can significantly reduce the food intake of mice and promote the weight loss of mice. And compared with the control group, no obvious abnormality was found in the health of the mice after the polypeptide was administered.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


